Муларды когда их можно забивать: Когда забивать уток мулардов

Содержание

описание и кормление, выращивание и когда можно резать

Муларды относятся к бройлерным кроссам уток. Кросс был выведен во Франции в середине 20 века. Перед селекционерами ставилась задача улучшить скороспелость пекинской утки. Для этого её скрещивали с особями мускатной породы. В результате появилась птица с высокой скороспелостью и хорошей мясной продуктивностью.

 Загрузка …

Специалисты предупреждают, что для омолаживания стада требуется приобретать молодняк или проводить селекцию, создавая птичьи семьи из уток пекинской и мускатной породы. От самих мулардов потомство ожидать не приходится. Они бесплодны. Их разводят исключительно для получения мяса. Оно нежирное, сочное, с нежными и тонкими волокнами. Каково описание породы? Как откармливать поголовье?

Характеристика мулардов

Утки породы мулард имеют большие размеры, но тело не выглядит рыхлым. Телосложение подтянутое, крепкое. У птицы большая голова, длинная и широкая шея, мускулистое тело. Конечности удлинённые, посадка горизонтальная, но высокая. Издалека птицы похожи на гусей. Что представляют собой утки муларды? Когда можно резать молодняк:

  • основное оперение у мулардов белое. На голове, груди, спине – тёмные пятна. Птенцы появляются с пухом оливкового оттенка с тёмными разводами. Самок и самцов не отделяют. При выращивании это не имеет значения. Птичьи семьи из мулардов не составляют. Особи обоих полов почти одинаково набирают вес. Выращивают и селезней и самок вместе;
  • клюв и плюсны у птицы оранжевого цвета. На клюве чёрные пятна. Длина клюва 14 см. Он удлинён и немного расплющен по краям. Зубцов на внутренней стенке клюва у мулардов нет;
  • для уток характерен ускоренный рост и набор массы тела. Молодняк выращивают до 60 дней. К этому времени утята набирают 4 кг. В дальнейшем рост у них замедляется;
  • взрослый селезень может весить до 7 кг, самка на 500 г меньше;
  • для утки мулардов используют клеточное содержание. В качестве корма применяют сухие концентрированные смеси. Традиционное кормление уток используют только в домашних хозяйствах, если разведение поголовья не является бизнесом;
  • утка мулард ест много. Об этом говорят отзывы подворцев и фермеров. Для того чтобы получить большую печень у птицы, используют принудительное кормление.

Выращивают птицу до 2 летнего возраста не только чтобы получить от неё мясо, но и печень. У особей она составляет 1/8 часть тела. Если масса тела 4 кг, то печень будет весить 500-550 г. Во Франции данный продукт очень ценится. Из него готовят фуа-гра.

Как ухаживать за поголовьем?

Молодняк приобретают у заводчиков. Рекомендуют покупать недельных птенцов, но стоят они дороже, чем суточные утята. Первые 2 недели молодняк содержат в брудере. На 1 м2 располагают до 15 особей. Для них рекомендуют выдерживать температуру в 30 С, световой день 24 ч. Начиная с 14 дня, продолжительность светового дня начинают сокращать.

К 30 дню его доводят до 16 ч. Меняется температурный режим. Утята комфортно себя чувствуют при температуре 20-25 С. Следует обеспечить им свежий воздух. Для этого в помещении устанавливают вентиляционную систему:

  • клетки поднимают над полом на высоту 15 см. Это может предохранить утят от сквозняков, до поголовья не доберутся мелкие грызуны, которые наносят большой урон поголовью;
  • клетка представляет собой металлический или деревянный каркас, обтянутый сеткой с мелкой ячейкой;
  • под напольную сетку устанавливают поддон. В него будут проходить грязь и помёт;
  • поддоны вымывают ежедневно;
  • кормушки и поилки выносят за пределы клеток, чтобы содержать в них чистоту и сухость;
  • водоём для утят не нужен. Ёмкость с водой им тоже не ставят.

Каждую неделю проводят расселение стада. В месячном возрасте утят переводят в просторные клетки. На 1 м2 должно находиться не более 3 голов. Обязательно следят за скученностью поголовья. В противном случае в стаде может начаться расклёв. Особи выщипывают у своих собратьев перья, нанося им раны. Среди мулардов очень развит каннибализм.

В некоторых домашних хозяйствах мулардов держат в загоне, на глубокой подстилке. В летнее время поголовье выводят на выпас. Для выпаса рекомендуют построить вольер: огородить растительную площадку сеткой. У уток мулардов не развито стадное чувство. Собрать их при вольном выпас на диком лугу будет сложно.

В домашних условиях перед выпасом им дают немного зерновой смеси с грубым кормом. В качестве грубого корма используют сено, которое запаривают и измельчают. Оно необходимо, чтобы у птиц не развивались патологии в кишечнике. Особи не смогут съесть слишком много травы. В противном случае они будут страдать тимпанией, закупоркой зоба и кишечника. Вечером им дают зерновую смесь. Часто в неё добавляют творог и обрат.

Откорм концентратами

Если разводить мулардов как бизнес, для кормления используют комбинированные корма. Смеси сбалансированы и по белку, и по углеводам, и по жиру. Едят утки муларды много, но большое количество белкового корма способствует ускоренному росту мышечной массы. Смеси выбирают в соответствии с возрастом поголовья. Необходимо следить за утками мулардами, за их кормлением, чтобы развитие поголовья и выращивание утят было правильным:

Полезная информация
1первые 3 недели утятам дают комбикорм стартовой версии; рекомендуют использовать смеси для птицы бройлерной породы. Хорошие результаты можно получить, используя ПК 21-1. Среднесуточный прирост около 40 г
2с 4 по 7 неделю идёт, собственно, откорм. В этот период особи ежедневно набирают до 65 г. Для откорма выбирают подростковую версию концентратов. Рекомендуют приобрести ПК 22-1
3с 2 месяцев начинается усиленный откорм молодняка. Его готовят к убою. В это время выбирают комбикорм версии «финиш»: ПК 23-1. Ежедневно утёнок прибавляет в весе до 67-70 г

Концентратов должно быть достаточно, чтобы молодняк не был голодным. Недельные утята должны есть каждые 2 ч. Концентраты подают в виде мешанок. Сухую смесь запаривают в кипятке или разводят в обрате. Для нормального развития особи в корм добавляют мел или толчёную скорлупу. Общее количество корма – 75 г.

Через 3 недели количество кормлений постепенно уменьшают. Поголовье получает концентраты 4 раза в сутки. Суточная норма для утёнка – 225 г. Необходимо смотреть за сменой пера. Если оно плохо растёт, то необходимо в корм добавлять премиксы, рыбий жир, мел. В противном случае, есть риск развития каннибализма в стаде.

В возрасте 60 дней количество кормлений сокращается до 3 раз. Молодняк получает одинаковое количество корма. Суточная порция составляет 260 г. Если ведётся откорм уток для увеличения печени, то объём корма увеличивают. Каждая особь получает в сутки 340 г. Если птица не желает употреблять смесь, она ещё не проголодалась, то корм вводят принудительно. Для этого используют зонд.

Принудительное введение корма выглядит как насилие, но, судя по отзывам специалистов, даёт хорошие результаты. Фермер вынужден использовать данную методику кормления, потому что утка сама не способно съесть большое количество смеси. Чтобы у особи не произошла закупорка зоба, ей дают много воды. Откорм продолжается месяц.

Традиционное кормление

Откорм уток мулардов концентратами используют в основном фермеры, которые предполагают получить от продажи утиного мяса хорошую прибыль. Птицеводы часто обсуждают, чем кормить поголовье при отсутствии комбикорма. Если мулардов разводят не для бизнеса, а для личного использования, в домашних условиях, то прибегают к традиционной методике кормления. Набор веса у уток мулардов будет не таким быстрым, но хозяин сэкономит на кормах.

В домашних условиях для утят готовят кормовые смеси самостоятельно. Первые 2 недели они получают 30-32 г корма на голову. В дальнейшем объём рациона увеличивается до 130 г. Начиная с 30 дня, порцию постепенно доводят до 220 г. Чтобы рацион был сбалансирован, предлагается использовать следующее количество кормов (рассчитан на 10 голов):

Наименование продукта (г)1-14 день15-30 день31-60 день
Варёное яйцо100
Кукуруза80400700
Пшеница50300200
Пшено3080190
Обрат20
Костная мука158070
Рыбная мука1090120
Рыбий жир310
Жмых подсолнечника60120
Грубый корм150500
Дрожжи4060
Травяная мука60150
Мел2580
Соль510

 

Варёное яйцо дают утятам только первые 2 недели. Если были приобретены птенцы недельного возраста, то сразу используют зерновые смеси. Рыбий жир дают 1 раз в неделю. Его смешивают с зерном или вводят пипеткой в клюв каждому утёнку.

С 14 дня в корм вводят гравий, 1 г на голову. Зерновые смеси измельчают на дробилке. До консистенции муки их не доводят. Часть зерна заменяют концентратами. С 30 дня зерно не дробят, если оно мелкое. Гравия птицам положено 2 г на голову.

Утки муларды не прихотливы к еде. При разведении поголовья в домашних условиях их кормят овощами и зеленью с огорода. Они едят капусту, салат, перья зелёного лука. Им полезна морковь и свёкла, но корнеплоды рекомендуют измельчить. Полезен для уток мулардов отварной картофель. Он способствует набору мышечной массы. Подворцы чаще всего используют сезонное кормление. Летом стадо находится в загоне. В зимнее время птицу заводят в помещение.

Как разводить мулардов?

Если на подворье выращивают мускусных уток и особей пекинской породы, то необязательно обращаться к заводчикам, чтобы приобрести птенцов мулардов. Создают птичьи семьи в домашних условиях. Они состоят из 3 самок пекинской породы и 1 селезня индоутки. Для семьи отделяют вольер с гнездом. Лучшее время для создания птичьих семей является апрель-май. Пекинская утка начнёт откладывать оплодотворённые яйца, но их для инкубации не используют. Материал собирают только через месяц общения птиц разных пород.

Для созревания яиц используют инкубатор или наседку. Под наседку укладывают до 20 яиц. Рекомендуют посадить в гнездо одну из мускусных уток. У них лучше развит материнский инстинкт. Для наседки отделяют тихий уголок. В нём устанавливают отдельную кормушку, поилку и таз с водой. Если утка не выходит из гнезда более суток, то её следует взять на руки и поднести к кормушке.

Инкубационный период продолжается 28 дней, но проклёв начинается уже на 26 день после того как под наседку положили яйца. Заметить появление птенцов можно по разбившейся скорлупе. Утка выбросит её из гнезда. Мокрых утят она берёт под крыло. После того как они высохнут, мать подводить их к кормушке и к поилке, обучая их есть и пить. Подворцы дают хорошие отзывы о молодняке, полученным данным способом. Утята показывают хорошую мясную продуктивность. В 2 месяца домашние утки муларды весят 3,5 кг.

Время забоя

Уток мулардов используют в возрасте 60 дней, но фермер или подворцы самостоятельно решают, когда им вести поголовье на убой. В 2 месяца особи весят 3,8-4 кг. Их можно резать, но если этого покажется мало, то время забоя отодвигают: продолжают откорм. В 4 месяца утки набирают 4,2 кг. Дальнейший рост молодняка не будет интенсивным. Для получения большой печени особей откармливают до 70 дней и дольше.

Обязательно учитывают период линьки молодняка. Утята начинают менять перо в 2,5 месяца. Муларды худеют. На обновление перьевого покрова им требуется много белка и микроэлементов. Отмечается резкое снижение массы тела. Забой рекомендуют проводить перед линькой.

До забоя поголовье перестают кормить. Из вольера или из клетки убирают кормушки и поилки. Птицы должны очистить кишечник от пищевого комка. Тушку рекомендуют подержать в горячей воде, чтобы лучше отходило перо. Воду берут температурой в 70 С. Кипяток не используют. От него мясо теряет свой розовый оттенок. Товарный вид тушки изменится в худшую сторону.

Фермеры отмечают, что мулардам необходимо особое кормление, чтобы они показывали хорошую продуктивность. Требования к содержанию минимальны. В помещении должен быть свежий воздух. Если поголовье содержат на подстилке. То её рекомендуют менять 1 раз в неделю. Мясо мулардов считается чистым. Уток не выпаивают антибиотиками, и не вводят им вакцины.

YouTube responded with an error: API key expired. Please renew the API key.

Когда забивать мулардов чтобы не было пеньков

Когда забивать уток чтобы не было пеньков?

Утки растут сравнительно быстро. Через два месяца их уже можно резать, хотя в это время может быть много пеньков из-за того, что утки еще не имеют хорошего перьевого покрова.

Лучший период – через три – три с половиной месяца.

Затем опять возможно образование колодок, потому что утки начинают линять на зиму.

Сложно угадать, с пенками утка или нет. Из одного и того же приплода, если порезать уток, некоторые могут быть с колодками, а некоторые – без них.

Утку с колодками придется ощипывать более тщательно, используя какие-нибудь инструменты, например, нож.

Когда резать уток, чтобы не было пеньков? Этот вопрос интересует начинающих заводчиков. Ведь если произвести забой уток в домашних условиях и не правильно определить сроки, тушка потеряет товарный вид, а ее ощипывание и разделка отнимут много времени. Советы опытных птицеводов, отзывы, видео помогут правильно определить оптимальные сроки проведения забоя уток.

В период линьки резать уток не рекомендуется. Тушка будет иметь множество пеньков, а ощипывать ее будет сложно

Когда резать уток, чтобы не было пеньков ?

Образование пеньков у водоплавающей птицы наблюдается в период линьки. Наступает она дважды в году – летом и осенью. За это время у пернатых происходит полная смена оперения. В период линьки резать уток не рекомендуется. Тушка будет иметь большое количество пеньков, а ее ощипывание доставит много трудностей.

По отзывам опытных птицеводов становится очевидным, что оптимальное время забоя пекинских уток наступает приблизительно на 65 день. В этом возрасте птица имеет вес около 2 кг, а тушка еще не очень жирная. Точное время забоя указать невозможно. Оно зависит от условий содержания, кормления, региона.

Мускусных уток отправляют на забой в домашних условиях позднее. Самцов рекомендуют резать приблизительно на 85 день, а самок на 70 – 75. Опытные заводчики научились определять время забоя по внешним признакам. Во время осмотра кожных покровов пеньки легко прощупываются. Если их нет – утку пора отправлять на забой, а ощипать тушку не составит труда.

Забой уток в домашних условиях: методы ощипывания, разделка тушк и

Образование пеньков у водоплавающей птицы наблюдается в период линьки. Наступает она дважды в году – летом и осенью

Существует множество технологий разделки тушки

На фото одна из самых простых схем разделки тушки домашней утки

Когда резать уток, чтобы не было пеньков, виде о:

Хотите узнать, когда резать уток, чтобы не было пеньков? Важно правильно выбрать срок забоя пернатых. От этого зависит то, насколько трудно будет ощипать птицу. Решая, когда резать уток, стоит учитывать ее возраст, породу, условия содержания и питания.

В последнее время у российских фермеров и владельцев приусадебных участков, занимающихся разведением хозяйственной птицы, все более популярными становятся утки породы мулард. Отзывы об этом гибриде существуют только отличные. И это несмотря на то, что потомство он давать не способен.

Утки муларды являются смесью двух широко распространенных пород – мускусной и пекинской. Птица это высокопродуктивная и очень простая в уходе. Но, конечно же, соблюдать определенные технологии при ее разведении все же следует. Ниже в статье и разберемся с тем, что представляют собой утки муларды (отзывы и фото, описание) и как за ними правильно ухаживать.

Преимущества породы

Мускусные утки ценятся фермерами прежде всего за чистоплотность и относительно спокойный нрав. Мясо у птицы этой породы вкусное и совершенно нежирное. Однако у мускусных уток есть один довольно-таки серьезный недостаток: они очень медленно набирают вес. Пекинская порода хорошо известна всем владельцам приусадебных хозяйств. Именно эту утку и разводят в большинстве случаев в деревнях и на загородных участках. Основным достоинством этой породы является быстрый набор веса. Однако все без исключения фермеры считают пекинских уток крайне нечистоплотными и слишком крикливыми. К тому же и мясо у них, по мнению исключительного большинства владельцев птичников, слишком уж жирное.

Утки мулард сочетают в себе все положительные характеристики родительских пород и при этом абсолютно лишены их недостатков. По мнению многих владельцев приусадебных хозяйств, при должном уходе эта птица набирает вес быстрее даже скороспелых пекинок. Аккуратность – это также то, чем характеризуются утки муларды. Отзывы об этой птице у фермеров хорошие в том числе и потому, что она совершенно нешумная. Ко всему прочему, у мулардов еще и необыкновенно вкусное мясо – нежирное и сочное.

Краткое описание

По внешнему виду муларды похожи одновременно и на пекинских уток, и на мускусных. Но масса тела у них больше, чем у каждой родительской породы. Помимо всего прочего, к характерным признакам мулардов относят:

  • удлиненное массивное туловище;
  • желтые ноги:
  • длинную шею.

Окрас у этого гибрида может быть как темным, так и светлым. Но чаще всего муларды имеют оперение белого цвета и характерную черную «шапочку» на голове.

Особенности поведения

По мнению всех без исключения фермеров, гибрид это совершенно беспроблемный. Хотя утки муларды (отзывы владельцев приусадебных хозяйств позволяют судить о них как об одной из самых спокойных пород) немного умеют летать, крылья им подрезать, как мускусным, не нужно. Вес этой птицы значительный. А поэтому через забор она перелететь в любом случае не сможет.

Содержат мулардов обычно напольным методом. В приусадебных хозяйствах на зиму этих уток не оставляют. Потомство они давать не способны, держать же их на откорм более трех месяцев нецелесообразно.

Насколько выгодно выращивать

Утки породы мулард отзывы заслужили хорошие, и разводить их наверняка хотели бы многие дачники и фермеры. Однако стоят такие птенцы, к сожалению, довольно-таки дорого. Позволить себе приобрести их в большом количестве могут далеко не все фермеры. Но при желании из этой ситуации можно найти довольно простой выход.

Многие фермеры, желающие выращивать мулардов, для начала просто приобретают несколько мускусных селезней и десятка два пекинских уточек. Скрещивая эти породы в домашних условиях, вы можете легко получить своих собственных качественных мулардов. Единственное, о чем нужно позаботиться, если выводить этот гибрид у себя дома, так это о том, чтобы на подворье не было мускусных уточек. В противном случае селезни этой породы на пекинок просто-напросто не будут обращать внимания.

Вес утки мулард, отзывы о которых в этом плане очень даже неплохие, набирают практически моментально. Причем корма, как считают многие владельцы приусадебных хозяйств, они расходуют вполне рационально – на прирост мяса, а не жира. К возрасту 2-2,5 мес. при правильном уходе эти птицы набирают до 3,5-3,6 кг. В это время обычно и производят их убой. Дольше этих уток, как и любых других, держать нецелесообразно. Дело в том, что после трех месяцев скорость набора веса у этой хозяйственной птицы замедляется, есть же она начинает очень много. К тому же в это время у уток происходит ювенальная линька. Если забить птицу после окончания этого процесса, на ее тушке будет много пеньков, в результате чего она потеряет товарный вид.

Утки мулард: отзывы фермеров

Конечно же, мнение об этой породе, поскольку в содержании она очень удобна, а по продуктивности превосходит многие другие разновидности, у птицеводов сложилось очень хорошее. Затраты на разведение мулардов окупаются очень быстро. Большинство фермеров считает, что эта птица, помимо неприхотливости и продуктивности, имеет еще одно немаловажное достоинство. Поскольку мясо у нее вкусное, реализовывать его очень просто. Тушки уток этой породы охотно покупают как обычные граждане, так и кафе или рестораны.

Как обустроить птичник

Помещение для уток этой породы подходит только светлое и сухое. В сарае нужно обустроить побольше окон. На трех уток должно приходиться не менее 1 м 2 свободного пространства. Пол в птичнике опытные фермеры советуют закрыть достаточно толстым слоем подстилки из соломы. Утеплять сарай и устраивать в нем вентиляцию следует только при круглогодичном разведении уток в больших количествах. В любом случае температура воздуха в птичнике не должна опускаться ниже 16-18 °С, а влажность – 60 %.

Разумеется, в сарае следует расставить кормушки-корыта. Ежедневные купания – это также то, что требуется таким гибридам, как муларды. Выращивание (отзывы о таких утках, как уже упоминалось, хорошие в том числе и из-за их неприхотливости) этой породы возможно и при отсутствии на участке естественного водоема. Все, что нужно сделать для того, чтобы муларды чувствовали себя комфортно, так это установить в выгуле большие емкости, наполненные водой. Этого уткам будет вполне достаточно. Собственно, сам выгул обустраивают непосредственно рядом с птичником, используют в качестве ограждения сетку-рабицу.

Особенности кормления

Итак, для хозяйства приобретены утки муларды. Чем кормить (отзывы об этих гибридах хорошие в том числе и из-за того, что они не слишком прожорливы) молодняк – это, конечно же, первый вопрос, который задают себе фермеры. Ответ на него несложен. В крупных хозяйствах и на птицефабриках в первое время утятам дают специальные стартовые комбикорма. Владельцы приусадебных хозяйств кормят малышей чаще всего просто творогом и яйцом. Также птенцам дают кашки из пшена и риса. Их опытные птицеводы советуют кидать прямо на утят. Таким образом птенцов можно легко научить есть самостоятельно. Дело в том, что движущуюся пищу утки воспринимают гораздо лучше.

Трехдневным птенцам уже можно начинать давать зелень. Позднее (примерно через 10 дней) в рацион малышей вводят вареный картофель. Через некоторое время в меню включают овощи и корнеплоды. Очень полезным кормом для уток этой породы считается свекла. Однако давать ее птице следует аккуратно. Дело в том, что этот корнеплод слабит кишечник. Морковку можно скармливать в больших количествах. Причем как в свежем виде, так и отварном.

Обязательно в рацион утят следует включить продукты, содержащие животный и растительный белок. В мешанки из корнеплодов и зелени нужно добавлять обрат и творог. Также в рационе уток мулардов обязательно должны присутствовать минеральные и витаминные добавки. Помимо мешанок, птица должна получать запаренное зерно (пшеницу, кукурузу) или отварную кашу. Для того чтобы немного сэкономить на кормах, в зерно уткам можно подмешивать отруби. Очень полезной добавкой для этих птиц считаются и пекарские дрожжи. Их нужно давать в количестве 1 г на голову ежедневно.

Поилки у уток всегда должны быть полными. Во-первых, эта птица очень много пьет, а во-вторых, после еды она в обязательном порядке полощет забитый кормом нос.

Рекомендации по инкубации

Таким образом, в кормлении относительно неприхотливы муларды. Разведение в домашних условиях (отзывы о породе хорошие и по причине почти стопроцентной выживаемости молодняка) – дело также не слишком сложное. Для получения утят этой породы нужно просто скрестить пекинских уток с мускусными селезнями. Многие фермеры и владельцы загородных участков считают, что при желании можно сделать и наоборот. Однако при скрещивании пекинских селезней и мускусных уточек гибриды получаются менее продуктивными. Это следует иметь в виду.

Если уток мулардов предполагается разводить в больших количествах, яйца, конечно же, лучше не подкладывать под наседок, а инкубировать. Получить молодняк этой породы искусственным путем под силу даже начинающему фермеру. Инкубировать птенцов этого гибрида, по мнению многих владельцев приусадебных хозяйств, гораздо проще, чем, к примеру, тех же цыплят. Хорошая выводимость – это также то, чем характеризуются утки муларды. Фото (отзывы об этом гибриде замечательные еще и потому, что его молодняк отличается крепостью и здоровьем) вылупившихся в инкубаторе птенцов представлено ниже. Как видите, процесс этот во многих случаях проходит вполне успешно. Но на стопроцентную выводимость в инкубаторе рассчитывать, конечно же, все же не стоит. Если из заложенных ста яиц вылупится 60 здоровых утят – это уже очень даже неплохой результат.

Опытные фермеры считают, что самым благоприятным временем для получения птенцов мулардов является апрель – июнь. Наиболее же подходящий возраст мускусных селезней и пекинок – 7-10 месяцев. Яйца для инкубации можно собирать в течение одной недели. Хранить их следует в прохладном месте. Собственно, саму инкубацию проводят в обычном для утиных яиц режиме.

Как ухаживать за вылупившимися птенцами

Разведение мулардов, отзывы о которых отличные, будет успешным, конечно же, только при условии соблюдения технологии ухода за молодняком. После вылупления утят обычно оставляют в инкубаторе до обсыхания. Затем их переносят в коробку. Поскольку сырость маленьким птенцам противопоказана, в ней предварительно обустраивают решетчатое дно.

Для большого количества утят вместо коробки целесообразно использовать брудер. Каркас этого приспособления можно собрать из бруса, а обшивку сделать из фанеры и поликарбоната. Внутрь обязательно нужно поместить специальную обогревающую лампу для брудера. Приобрести ее можно, к примеру, в зоомагазине. Вешать лампу следует таким образом, чтобы утята не обожглись, и внутри брудера был бы хотя бы один затененный уголок.

Обогрев в коробке устраивают так же. Только в данном случае используют обычную лампу накаливания. Конечно же, в коробку или брудер следует поместить кормушки и поилки.

Рекомендации по уходу за молодняком

Через три недели после вылупления мулардиков можно переводить в сарай. При откорме на мясо эту птицу обычно держат напольным методом. Утром ее выпускают на выгул, а вечером загоняют обратно в сарай. Утки мулард, отзывы о которых отличные в том числе и из-за их неприхотливости, как и любая другая водоплавающая птица, очень любят купаться. Позволять им плавать и плескаться в установленных в выгуле емкостях, однако, можно только с двухмесячного возраста – после того как они полностью оперятся.

Кормить уток желательно 3 раза в день – утром, в обед и вечером. Забивают птицу в 2,5-3 месяца.

Откорм на фуа-гра

Мы рассмотрели основную информацию о таких птицах, как утки муларды (выращивание в домашних условиях, отзывы). Мнение об этом гибриде хорошее не только потому, что у него вкусное мясо. Гурманами очень ценится и печень этой птицы. Из нее в ресторанах готовят особое блюдо, называемое фуа-гра. В особенности оно популярно во Франции. Но и в России это блюдо также ценится и является довольно-таки востребованным. Откорм уток мулардов для получения качественной печени производится по особой технологии.

В первые три недели жизни уход за птенцами осуществляют обычным способом. Затем птицу помещают в клетки, размер которых должен быть таким, чтобы она не могла много двигаться. Кормят подросший молодняк, выращиваемый на печень, пищей, содержащей очень большое количество протеинов и крахмала. Включают в рацион и специальные минеральные и витаминные добавки.

С 8-10-го дня жизни уток начинают кормить принудительно, проталкивая пищу в глотку с помощью специального шнека с трубкой. За день мулард, выращиваемый по такой технологии, должен получать не менее 1,8 кг зерна. Длится принудительный откорм обычно 12-21 день. При таком содержании печень у птицы вырастает в 10 раз больше обычных размеров. При этом она не теряет своих отличных вкусовых качеств.

Таким образом, утки породы мулард, отзывы о которых положительны в том числе и из-за их печени, – птица для разведения на самом деле очень выгодная. Конечно, содержание их по описанной выше технологии – процедура довольно сложная и может отнимать много времени. Однако все усилия при таком подходе к делу обычно вознаграждаются сторицей. Печень мулардов сдают в дорогие рестораны, и стоит она очень недешево.

Болезни

Крепкое здоровье – это также то, чем характеризуется домашняя утка мулард. Отзывы об этой породе хорошие в том числе и потому, что она очень устойчива к разного рода инфекциям. В этом плане каких-либо хлопот муларды своим хозяевам обычно не доставляют. Даже холод и серьезные перепады температур они переносят вполне спокойно.

Редко, но все же случается так, что эти утки заболевают аспергиллезом или клоацитом. В первом случае для лечения применяют раствор медного купороса (внутрь), во втором – йод и цинковую мазь.

Заключение

Как видите, утки муларды, выращивание в домашних условиях (отзывы фермеров в данном случае говорят сами за себя) которых – процедура не слишком обременительная, птица на самом деле продуктивная в плане содержания на мясо, да и печень выгодная. Конечно же, стоят утята этой породы недешево (примерно 1,5 доллара за штуку). Однако и выгоду при их разведении можно получить немалую. В особенности в том случае, если утята будут инкубированы прямо на ферме.

Муларды. Когда резать? | Деревенька моя. Возле порта

этой уточке было чуть не меньше трех месяцев

этой уточке было чуть не меньше трех месяцев

Мы держим домашнюю птицу в своем хозяйстве уже лет семь, начинали с самого простого: кур-несушек и бройлеров на мясо. Конечно, и с курами тоже бывает всякое, бройлеры тоже капризули еще те.

Потом добавили индеек мясных, выращиваем их уже два года.

Не очень я стремилась заводить водоплавающую птицу гусей и уток, потому что помнила еще свои давние годы, когда жила я на Северном Кавказе и держала как-то несколько штук. Птица вкусная, но возни с ощипыванием много.

Тем более, что в соседней деревне, одна семья держала уток и хозяйка мне рассказывала, что стараются они забивать уток не позже, чем в три месяца, потом начинают линять, щипать их тяжело, да и вес они в это время практически не набирают. Осенью они забивают всех уток и складываю в морозильную камеру, чтобы затем продавать к Новому году, когда самы большой спорос.

Но так как, покупатели, покупая индеек и цыплят спрашивали про уток, решили мы с мужем в этом году попробовать завести мулардов.

Подкупило, что при чтении статей об этом утином кроссе везде расхвалились вкусовые качества мяса и сравнительно небольшая жирность. Когда есть умеренный жирок, я всегда «за», но обычные белые утки на мой вкус чересчур жирные.

Попробовали мы зарезать утку приблизительно в два месяца и две недели, так как мы покупали слегка подрощенных утят, возраст определяли приблизительно. По весу тушка получилась 2, 8 кг, пеньки от перьев присутствовали, что-то даже выдирали пассатижами. Вкус получился запеченной утки — просто отменный!

готовый продукт

готовый продукт

Конечно, утка это лакомство и в известной мере баловство, потому что мяса в ней не так уж и много, но зато оно душистое.

Затем мы резали наших мулардов с периодичность в неделю — десять дней. Пеньки каждый раз присутствовали.

Методом проб и ошибок, также спасибо опытным утководам, которые писали советы в комментариях, способ для приготовления тушки у меня такой:

  • горячая вода не менее 80 градусов, можно до 90. тушку опускаю в горячую воду. Если не собирать пух, можно бултыхать, как душе угодно, я стараюсь просто аккуратно макать. По времени приблизительно минуту.
  • заворачиваю в несколько слоев ткани плотно и оставляю. Очень удобно, если есть заказы на кур или индеек и вода практически готова и пока утка доходит, можно несколько штук разделать
  • у меня стол металлический, кладу вниз грудкой, эта сторона быстрее остывает, а самые проблемные места у утки крылья и плечи
  • через полчаса, минут сорок, разворачиваю и начинаю ощипывать
  • если утка хорошо «заварилась» то щиплются и пеньки тоже
  • если всё же крылья не дошли, приношу утюг и через мокрую тряпку пропариваю эти места еще раз

Конечно, обилие мелкого пуха никуда не девается, но в принципе всё удаляется довольно легко.

После мулардов мы взяли уток Стар 53 и первую резали на днях, так вот, может, утка еще молодая, может, кожа у них более нежная, но на шее при этом способе кожа рвалась. Возможно им нужно делать температуру горячей воды ниже.

Посмотрим в следующий раз.

Мулардов у меня от 34 штук осталось три, самые маленькие, как-нибудь для себя зарежем. И сейчас 33 утки Стар 53 в наличии.

Так что поле для совершенствования в ощипывании еще есть!

Утки-муларды – описание, выращивание, возможность выведения в домашних условиях — SadimVmeste.ru

Многих хозяев приусадебных участков и дачников привлекла новая порода уток, появившаяся несколько лет назад на рынке – с черной точкой на голове. Что это за птица, как ее кормить и выращивать? Эта тема действительно интересует многих, поэтому нужно решить, нужны ли вам именно этот гибрид, и выгодно ли вам его выращивать?

Что это за птица?

Эта утка называется мулард. Их еще именуют «мулатками» – белые, как пекинки, а на голове – черное пятно. Хотя на самом деле муларды бывают самых разных расцветок. Это гибрид мускусной утки и некоторых пород домашних, или же скрещивание с пекинской. Потомства давать они не могут, поскольку стерильны. Но муларды хороши при выращивании на мясо, то есть это птица одного поколения: вылупилась – выросла – съели!

Некоторые самцы, следует быть объективными, проявляют половой инстинкт, могут даже покрывать женские особи. Когда утки достигают половой зрелости, они иногда даже несут яйца, но утята из них никогда не вылупляются. Это многократно доказано в разнообразных опытах скрещивания.

К сожалению, не разобравшись, и покупая на рынке мулардов (а некоторые бессовестные продавцы умышленно замалчивают тот факт, что проданная ими птица не размножается), многие потом разочаровываются. Ведь хозяева собственного подворья покупают их в основном для того, чтобы быть с мясом, а в дальнейшем разводить эту птицу самостоятельно, уже не тратясь на покупку молодняка, то есть – иметь потомство. Но, как мы уже говорили, от мулардов этого не дождешься. Особенно разочаровывает многих то, что за них плачены приличные деньги (эта птица – не из дешевых), а вот разводить их не удается.

Однако, много и тех, кто из года в год покупают мулардов и очень ими довольны. Особенно выгодно это для дачников. Весной покупают, а если в семье есть пенсионер, который может все лето провести на даче, да еще когда рядом – водоем и есть где выпасать (эти утки очень охотно щиплют травку), то с относительно небольшими затратами, ведь совсем без комбикорма их тоже не вырастишь, на осень вся семья – с мясом.

Мясо и печень

У уточек живая масса немного ниже по сравнению с селезнями, но у этого гибрида нет такого четкого полового различия, как у тех же мускусных уток. В весе разница между особями разного пола составляет примерно пол килограмма. На принудительном откорме (когда уток сажают в ящики, накрывают, не позволяя вставать, и обильно кормят кукурузой) прирост массы — около пол килограмма, в том числе 500-550 г печени. При производстве в промышленных масштабах жирной птичьей печени в Европе сейчас широко используют именно мулардов, а не гусей, как раньше. Их можно откормить значительно быстрее (за две недели), и при меньших затратах кукурузы.

Домашнее выведение

Как утверждают некоторые хозяева, дома также можно вывести этих птиц. Для этого нужно иметь несколько мускусных уток и хорошего белого пекинского селезня. Или, наоборот, мускусного селезня скрещивают с пекинскими утками. Содержать такое стадо нужно отдельно от всей другой птицы. От такого скрещивания под наседкой выводится 80-100% утят, а в инкубаторе – 57-60%. Поместные утята отмечены повышенной энергией роста, обычно через два месяца они уже превышают вес своих родителей. В 60 дней они весят (при нормальном кормления, конечно) 3-3,5, в 90 дней – 5,5-6 килограмма. Мясо очень вкусное и совсем не похоже на полученное от мускусных уток.

Выращивание утят

Выращивая утят без наседок, в первые 5 дней нужна температура 20-22 С в помещении; и 28-30 С — возле источника тепла. После первой недели жизни ее постепенно снижают, и доводят до 18 С. Сначала освещение должно быть круглосуточным, но постепенно, уже до одиннадцатого дня доводят до 16 часов.

Выращивать нужно непременно на глубокой подстилке. Вполне можно использовать старое сено, солому, а то и стружки, пересыпав их известью-пушонкой. Опилки в первые дни лучше не использовать, поскольку птенцы их склевывают, что может вызвать падеж.

Если погода теплая, мулардиков уже через пару дней после появления на свет постепенно приучают к выгулу.

Особенности кормления

Только что вылупившиеся утята часто не понимают, как есть самостоятельно, и погибают. Поэтому, купив и принеся домой, напоите их каждого принудительно чуть розовой марганцовкой с помощью пипетки, затем, взяв темный лист картона, рассыпьте на нем смесь крутого яйца и вареной каши. А также обсыпьте кормом самих утят. Они при этом начнут хватать корм, который двигается.

Обычно через сутки — двое они начнут кормиться самостоятельно. Сначала их кормят влажными, но обязательно – рассыпчатыми мешанками, чтобы те не забивали им клювики. Свежую зелень дают с 3-х дней в смесях. Начиная с 10-го дня, во влажные мешанки можно добавлять вареный толченый картофель.

Если вы планируете выпускать молодняк на водоем, можно это делать с двухнедельного возраста. Если водоема рядом нет, попробуйте все же сами добывать для ряску (ее вылавливают сачками из прудов). От нее они мгновенно растут и не болеют. Видимо, сказывается природа, ведь утка все же – птица водоплавающая. Если утки на воде, достаточно для них трехразового кормления в день, а с месячного возраста можно переходить на двукратную подкормку зерном.

Для утят минеральная подкормка: мел, яичная скорлупа, ракушка, известняк — необходимость. Лучше всего, если все это будет находиться в отдельной кормушке постоянно, и добавляться по мере использования.

Следует знать, что для уток потребность в воде огромна, и она у них постоянно должна быть. Поилки нужны достаточно глубокие, чтобы можно было в них прополаскивать носовые ходы, которые забиваются влажными смесями.

Рацион расширяют постепенно. Так, вареные яйца добавляют в корм только первые 10 дней. До месячного возраста следует давать обезжиренный творог и молоко. С первых дней до десятидневного возраста дают лишь мелко дробленное или молотое цельное зерно, затем к нему начинают добавлять зерноотходы. Полезны уткам пшеничные отруби, разнообразные шроты, варенные мясные отходы, мясо-костная мука и вареный картофель, немного дрожжей пекарских (в сутки — примерно по грамму на голову). Обязательно нужна ракушка, заменить ее в полной мере гравий не может, хотя он также должен присутствовать в рационе, чтобы пища нормально переваривалась.

Целесообразен и экономически выгоден срок выращивания уток – 60 дней, а при наличии достаточного количества не дорогих кормов – 90 дней. В промежутке между этими сроками забивать уток нежелательно, поскольку в возрасте около 70 дней молодняк начинает линять, утки худеют, к тому же, тушки очень плохо обрабатывать – вместо полноценных перьев – сплошь пеньки, зачатки еще не отросших перьев.

выращивание в домашних условиях, кормление, отзывы

Птицеводство » Утки

0

6216

Рейтинг статьи

Кира Столетова

Среди всех домашних птиц, пользующихся наибольшим спросом у отечественных и зарубежных фермеров, одно из самых видных мест занимают утки. И это вполне закономерно, ведь рассматриваемые пернатые обладают множеством неоспоримых преимуществ. Они довольно неприхотливы, а их мясо способно похвалиться отличными вкусовыми качествами.


Забой уток в домашних условиях

Кроме того, из утят они довольно быстро превращаются во взрослых особей, а потому совсем неудивительно, что такая тема, как забой уток в домашних условиях, является стабильно популярной. Разумеется, подобное мероприятие нельзя назвать приятным, однако во множестве случаев без него действительно не обойтись, что делает раскрытие этой темы всецело оправданным решением.

Когда резать уток, чтобы не было пеньков ?

Образование пеньков у водоплавающей птицы наблюдается в период линьки. Наступает она дважды в году – летом и осенью. За это время у пернатых происходит полная смена оперения. В период линьки резать уток не рекомендуется. Тушка будет иметь большое количество пеньков, а ее ощипывание доставит много трудностей.

По отзывам опытных птицеводов становится очевидным, что оптимальное время забоя пекинских уток наступает приблизительно на 65 день. В этом возрасте птица имеет вес около 2 кг, а тушка еще не очень жирная. Точное время забоя указать невозможно. Оно зависит от условий содержания, кормления, региона.

Мускусных уток отправляют на забой в домашних условиях позднее. Самцов рекомендуют резать приблизительно на 85 день, а самок на 70 – 75. Опытные заводчики научились определять время забоя по внешним признакам. Во время осмотра кожных покровов пеньки легко прощупываются. Если их нет – утку пора отправлять на забой, а ощипать тушку не составит труда.

Дальнейшие действия

Окончательно распотрошив битую птицу, можно приступать к ее промывке проточной водой, просушиванию и последующей заморозке. Если же тушка предназначается для приготовления того или иного блюда без промедления, то последовательность дальнейших действий выглядит следующим образом:

  1. Прежде всего производится отделение окороков посредством подходящего ножа — так, чтобы мясо захватывалось как можно ближе к позвоночнику. С крыльями следует поступать таким же образом.
  2. Филейную часть нужно резать вдоль, а для отделения ребер и хвоста можно воспользоваться ножницами.
  3. Рубить мясо желательно на несколько порционных кусков, не забыв предварительно избавиться от сальной железы. Последняя может сделать вкус и запах утиного мяса гораздо менее приятным, а потому игнорировать данную рекомендацию не следует.
  4. Что касается шкурки, то ее можно перетопить прямо с жиром, а оставшийся хребет битой птицы есть смысл использовать при изготовлении различных первых блюд.

Когда резать уток, чтобы не было пеньков? Этот вопрос интересует начинающих заводчиков. Ведь если произвести забой уток в домашних условиях и не правильно определить сроки, тушка потеряет товарный вид, а ее ощипывание и разделка отнимут много времени. Советы опытных птицеводов, отзывы, видео помогут правильно определить оптимальные сроки проведения забоя уток.

Забой уток в домашних условиях: методы ощипывания, разделка тушк и

Образование пеньков у водоплавающей птицы наблюдается в период линьки. Наступает она дважды в году – летом и осенью

Существует множество технологий разделки тушки

На фото одна из самых простых схем разделки тушки домашней утки

Когда резать уток, чтобы не было пеньков, виде о:

Хотите узнать, когда резать уток, чтобы не было пеньков? Важно правильно выбрать срок забоя пернатых. От этого зависит то, насколько трудно будет ощипать птицу. Решая, когда резать уток, стоит учитывать ее возраст, породу, условия содержания и питания.

В последнее время у российских фермеров и владельцев приусадебных участков, занимающихся разведением хозяйственной птицы, все более популярными становятся утки породы мулард. Отзывы об этом гибриде существуют только отличные. И это несмотря на то, что потомство он давать не способен.

Утки муларды являются смесью двух широко распространенных пород – мускусной и пекинской. Птица это высокопродуктивная и очень простая в уходе. Но, конечно же, соблюдать определенные технологии при ее разведении все же следует. Ниже в статье и разберемся с тем, что представляют собой утки муларды (отзывы и фото, описание) и как за ними правильно ухаживать.

Советы по разделке

Разделку домашней утки можно производить по разработанному алгоритму. Первое действие – аккуратно отрезать шею, оставив кусок кожи для маскировки разреза/раны. Затем работают с ногами и крыльями утки. Отсекают лапы на расстоянии 2-4 см от пяточного сустава, крылья отрезают по первый сустав.

Далее разрезают брюхо, удаляют все потроха. Желудок, легкие промывают, хранят отдельно. Обязательно срезают брюшной жир и копчиковую (сальную) железу в задней части. Эти элементы часто портят вкус утиного мяса при готовке. Через надрез внизу шеи удаляется зоб и пищевод. После этого утку тщательно вымывают и высушивают, тушка готова к хранению.

Забой уток – важный процесс, с технологией проведения которого должен быть знаком каждый заводчик пернатых. Начинают забой, когда особям исполнилось 60-70 дней. В это время их мясо нежное и диетическое, жировые наросты отсутствуют.

Если затянуть со сроками, качество тушки испортится: появятся пеньки и жесткость мяса. Самые популярные техники забоя уток – отрубание головы или перерезание артерии.

Преимущества породы

Мускусные утки ценятся фермерами прежде всего за чистоплотность и относительно спокойный нрав. Мясо у птицы этой породы вкусное и совершенно нежирное. Однако у мускусных уток есть один довольно-таки серьезный недостаток: они очень медленно набирают вес. Пекинская порода хорошо известна всем владельцам приусадебных хозяйств. Именно эту утку и разводят в большинстве случаев в деревнях и на загородных участках. Основным достоинством этой породы является быстрый набор веса. Однако все без исключения фермеры считают пекинских уток крайне нечистоплотными и слишком крикливыми. К тому же и мясо у них, по мнению исключительного большинства владельцев птичников, слишком уж жирное.

Достоинства и недостатки породы

Основным минусом этой породы является невозможность получения потомства. Но этот недостаток не способен перевесить ее достоинства.

Преимущества мулардов:

  • отличный выход мяса:
  • нетребовательность в уходе;
  • высокие вкусовые качества печени и мяса;
  • быстрый набор массы;
  • высокий уровень прибыли.

Данный гибрид подходит для личного подворья и профессионального выращивания. Популярность этого вида домашней птицы ежегодно растет.

Нужно учитывать, что стоимость молодняка мулардов выше, чем утят других пород.

  • Автор: Мария Сухоруких
  • Распечатать

Оцените статью:

  1. 5
  2. 4
  3. 3
  4. 2
  5. 1

(0 голосов, среднее: 0 из 5)

Поделитесь с друзьями!

Краткое описание

По внешнему виду муларды похожи одновременно и на пекинских уток, и на мускусных. Но масса тела у них больше, чем у каждой родительской породы. Помимо всего прочего, к характерным признакам мулардов относят:

  • удлиненное массивное туловище;
  • желтые ноги:
  • длинную шею.

Окрас у этого гибрида может быть как темным, так и светлым. Но чаще всего муларды имеют оперение белого цвета и характерную черную «шапочку» на голове.

Особенности поведения

По мнению всех без исключения фермеров, гибрид это совершенно беспроблемный. Хотя утки муларды (отзывы владельцев приусадебных хозяйств позволяют судить о них как об одной из самых спокойных пород) немного умеют летать, крылья им подрезать, как мускусным, не нужно. Вес этой птицы значительный. А поэтому через забор она перелететь в любом случае не сможет.

Содержат мулардов обычно напольным методом. В приусадебных хозяйствах на зиму этих уток не оставляют. Потомство они давать не способны, держать же их на откорм более трех месяцев нецелесообразно.

Насколько выгодно выращивать

Утки породы мулард отзывы заслужили хорошие, и разводить их наверняка хотели бы многие дачники и фермеры. Однако стоят такие птенцы, к сожалению, довольно-таки дорого. Позволить себе приобрести их в большом количестве могут далеко не все фермеры. Но при желании из этой ситуации можно найти довольно простой выход.

Многие фермеры, желающие выращивать мулардов, для начала просто приобретают несколько мускусных селезней и десятка два пекинских уточек. Скрещивая эти породы в домашних условиях, вы можете легко получить своих собственных качественных мулардов. Единственное, о чем нужно позаботиться, если выводить этот гибрид у себя дома, так это о том, чтобы на подворье не было мускусных уточек. В противном случае селезни этой породы на пекинок просто-напросто не будут обращать внимания.

Вес утки мулард, отзывы о которых в этом плане очень даже неплохие, набирают практически моментально. Причем корма, как считают многие владельцы приусадебных хозяйств, они расходуют вполне рационально – на прирост мяса, а не жира. К возрасту 2-2,5 мес. при правильном уходе эти птицы набирают до 3,5-3,6 кг. В это время обычно и производят их убой. Дольше этих уток, как и любых других, держать нецелесообразно. Дело в том, что после трех месяцев скорость набора веса у этой хозяйственной птицы замедляется, есть же она начинает очень много. К тому же в это время у уток происходит ювенальная линька. Если забить птицу после окончания этого процесса, на ее тушке будет много пеньков, в результате чего она потеряет товарный вид.

Способы ощипывания

После забоя утки тушку необходимо избавить от перьев и пуха. Существует несколько методов ощипывания птицы.

Однако, независимо от того, каким способом фермер собирается удалять перья, приступать к обработке тушки следует не ранее, чем через 2–3 часа после забоя утки.

Это время необходимо для того, чтобы подкожный жир пернатого застыл, а кожа не повредилась при обработке тушки. В противном случае вид утки окажется нетоварным и продать ее будет сложно.

Сухой метод

Это самый простой способ избавления птицы от оперения. Используется, когда утиную тушку планируют долгое время хранить в морозильнике или же собираются продавать. Действия по обработке утки просты:

  • Птицу кладут на газету (кусок материи), после чего крупные перья поочередно выдергивают из утиной тушки по направлению их роста, а мелкие — в противоположную сторону. Рекомендуется начинать обработку утки с груди, потом — переходить на спину, а заканчивать крыльями и хвостом.
  • После удаления крупных и мелких перьев следует опалить тушку, чтобы избавиться от мельчайших волосков. Делают это быстрыми движениями паяльной лампы, чтобы не подплавить подкожный жир и не прожечь кожу.
  • На последнем этапе утиную тушку тщательно отмывают от образовавшегося нагара.

Горячий способ

Отличается от сухого метода тем, что перед обработкой утку полностью ошпаривают водой, нагретой до 75–80 градусов, и на несколько минут помещают в ведро с такой же горячей водой. Применять для ошпаривания воду, нагретую выше 80 градусов, не рекомендуется, так как при обработке кипятком утиная кожа может лопнуть.

Утки мулард: отзывы фермеров

Конечно же, мнение об этой породе, поскольку в содержании она очень удобна, а по продуктивности превосходит многие другие разновидности, у птицеводов сложилось очень хорошее. Затраты на разведение мулардов окупаются очень быстро. Большинство фермеров считает, что эта птица, помимо неприхотливости и продуктивности, имеет еще одно немаловажное достоинство. Поскольку мясо у нее вкусное, реализовывать его очень просто. Тушки уток этой породы охотно покупают как обычные граждане, так и кафе или рестораны.

Хранение мяса

После того, как совершен убой и разделка птицы, встает вопрос о правилах хранения тушек. Кратковременное хранение требует температурного режима 0-4 градусов. Если рядом нет холодильника, то мясо заворачивают в чистую хлопковую ткань. Так продукт сохранится свежим до 5 суток.

Замороженное мясо утки

Для долгого хранения потребуется морозильник. Сохранить продукт можно и при помощи засолки. Рассол заготавливают из 1 литра воды и 300 г соли, а затем заливается в тушку. Для одной штуки потребуется 150 г жидкости.

Как обустроить птичник

Помещение для уток этой породы подходит только светлое и сухое. В сарае нужно обустроить побольше окон. На трех уток должно приходиться не менее 1 м 2 свободного пространства. Пол в птичнике опытные фермеры советуют закрыть достаточно толстым слоем подстилки из соломы. Утеплять сарай и устраивать в нем вентиляцию следует только при круглогодичном разведении уток в больших количествах. В любом случае температура воздуха в птичнике не должна опускаться ниже 16-18 °С, а влажность – 60 %.

Как ухаживать за поголовьем?

Молодняк приобретают у заводчиков. Рекомендуют покупать недельных птенцов, но стоят они дороже, чем суточные утята. Первые 2 недели молодняк содержат в брудере. На 1 м 2 располагают до 15 особей. Для них рекомендуют выдерживать температуру в 30 С, световой день 24 ч. Начиная с 14 дня, продолжительность светового дня начинают сокращать.

К 30 дню его доводят до 16 ч. Меняется температурный режим. Утята комфортно себя чувствуют при температуре 20-25 С. Следует обеспечить им свежий воздух. Для этого в помещении устанавливают вентиляционную систему:

  • клетки поднимают над полом на высоту 15 см. Это может предохранить утят от сквозняков, до поголовья не доберутся мелкие грызуны, которые наносят большой урон поголовью;
  • клетка представляет собой металлический или деревянный каркас, обтянутый сеткой с мелкой ячейкой;
  • под напольную сетку устанавливают поддон. В него будут проходить грязь и помёт;
  • поддоны вымывают ежедневно;
  • кормушки и поилки выносят за пределы клеток, чтобы содержать в них чистоту и сухость;
  • водоём для утят не нужен. Ёмкость с водой им тоже не ставят.

Каждую неделю проводят расселение стада. В месячном возрасте утят переводят в просторные клетки. На 1 м 2 должно находиться не более 3 голов. Обязательно следят за скученностью поголовья. В противном случае в стаде может начаться расклёв. Особи выщипывают у своих собратьев перья, нанося им раны. Среди мулардов очень развит каннибализм.

В некоторых домашних хозяйствах мулардов держат в загоне, на глубокой подстилке. В летнее время поголовье выводят на выпас. Для выпаса рекомендуют построить вольер: огородить растительную площадку сеткой. У уток мулардов не развито стадное чувство. Собрать их при вольном выпас на диком лугу будет сложно.

В домашних условиях перед выпасом им дают немного зерновой смеси с грубым кормом. В качестве грубого корма используют сено, которое запаривают и измельчают. Оно необходимо, чтобы у птиц не развивались патологии в кишечнике. Особи не смогут съесть слишком много травы. В противном случае они будут страдать тимпанией, закупоркой зоба и кишечника. Вечером им дают зерновую смесь. Часто в неё добавляют творог и обрат.

Особенности кормления

Итак, для хозяйства приобретены утки муларды. Чем кормить (отзывы об этих гибридах хорошие в том числе и из-за того, что они не слишком прожорливы) молодняк – это, конечно же, первый вопрос, который задают себе фермеры. Ответ на него несложен. В крупных хозяйствах и на птицефабриках в первое время утятам дают специальные стартовые комбикорма. Владельцы приусадебных хозяйств кормят малышей чаще всего просто творогом и яйцом. Также птенцам дают кашки из пшена и риса. Их опытные птицеводы советуют кидать прямо на утят. Таким образом птенцов можно легко научить есть самостоятельно. Дело в том, что движущуюся пищу утки воспринимают гораздо лучше.

Трехдневным птенцам уже можно начинать давать зелень. Позднее (примерно через 10 дней) в рацион малышей вводят вареный картофель. Через некоторое время в меню включают овощи и корнеплоды. Очень полезным кормом для уток этой породы считается свекла. Однако давать ее птице следует аккуратно. Дело в том, что этот корнеплод слабит кишечник. Морковку можно скармливать в больших количествах. Причем как в свежем виде, так и отварном.

Обязательно в рацион утят следует включить продукты, содержащие животный и растительный белок. В мешанки из корнеплодов и зелени нужно добавлять обрат и творог. Также в рационе уток мулардов обязательно должны присутствовать минеральные и витаминные добавки. Помимо мешанок, птица должна получать запаренное зерно (пшеницу, кукурузу) или отварную кашу. Для того чтобы немного сэкономить на кормах, в зерно уткам можно подмешивать отруби. Очень полезной добавкой для этих птиц считаются и пекарские дрожжи. Их нужно давать в количестве 1 г на голову ежедневно.

Поилки у уток всегда должны быть полными. Во-первых, эта птица очень много пьет, а во-вторых, после еды она в обязательном порядке полощет забитый кормом нос.

Рекомендации по инкубации

Таким образом, в кормлении относительно неприхотливы муларды. Разведение в домашних условиях (отзывы о породе хорошие и по причине почти стопроцентной выживаемости молодняка) – дело также не слишком сложное. Для получения утят этой породы нужно просто скрестить пекинских уток с мускусными селезнями. Многие фермеры и владельцы загородных участков считают, что при желании можно сделать и наоборот. Однако при скрещивании пекинских селезней и мускусных уточек гибриды получаются менее продуктивными. Это следует иметь в виду.

Если уток мулардов предполагается разводить в больших количествах, яйца, конечно же, лучше не подкладывать под наседок, а инкубировать. Получить молодняк этой породы искусственным путем под силу даже начинающему фермеру. Инкубировать птенцов этого гибрида, по мнению многих владельцев приусадебных хозяйств, гораздо проще, чем, к примеру, тех же цыплят. Хорошая выводимость – это также то, чем характеризуются утки муларды. Фото (отзывы об этом гибриде замечательные еще и потому, что его молодняк отличается крепостью и здоровьем) вылупившихся в инкубаторе птенцов представлено ниже. Как видите, процесс этот во многих случаях проходит вполне успешно. Но на стопроцентную выводимость в инкубаторе рассчитывать, конечно же, все же не стоит. Если из заложенных ста яиц вылупится 60 здоровых утят – это уже очень даже неплохой результат.

Опытные фермеры считают, что самым благоприятным временем для получения птенцов мулардов является апрель – июнь. Наиболее же подходящий возраст мускусных селезней и пекинок – 7-10 месяцев. Яйца для инкубации можно собирать в течение одной недели. Хранить их следует в прохладном месте. Собственно, саму инкубацию проводят в обычном для утиных яиц режиме.

Советы и рекомендации

Опытные птицеводы рекомендуют покупать вылупившихся из яиц утят в мае – июне. Тогда уже к концу августа – началу сентября молодые утки достигнут необходимого возраста, когда их можно забивать. Если следовать этому совету, то получится выполнить два важных условия:

  • Как и любых домашних птиц, уток лучше держать не в закрытых загонах или клетках, а выращивать так, чтобы днем они могли гулять на открытом воздухе, дополнительно питаться свежей травой, «набираться» от солнца витамина D. Летом это условие обеспечивается естественным образом.
  • Очень важно, чтобы забой птиц происходил до наступления заморозков. Если взять вылупившихся из яиц утят в середине лета, то первые осенние похолодания могут привести к тому, что молодые утки начнут наращивать жир и усиленно отращивать перья. А это ухудшит вкусовые качества мяса. Кроме того, ощипывать птицу станет значительно труднее — на ее коже после выдергивания перьев будут оставаться выступающие кожные образования (колодочки или, как их еще называют, пеньки). Чтобы пеньков не было, утка должна достичь оптимального для забоя возраста именно до наступления осенних заморозков.

В настоящее время любой желающий выращивать на частном подворье домашних птиц может приобрести птенцов самых разных видов и пород пернатых — вплоть до экзотических. На больших фермах утки нередко соседствуют с курами, индюками, гусями и даже страусами.

Однако если хозяйство маленькое, и фермер стоит перед выбором, каких птиц разводить на ограниченном пространстве, то можно смело рекомендовать выращивать на мясо уток. Они гораздо вкуснее кур, неприхотливы, у них более ранний возраст забоя, а масса этой птицы при этом превышает массу той же курицы.

Так что, остановившись на утках, остается выбрать лишь конкретную породу пернатых, а изысканным утиным мясом будущий хозяин птиц будет гарантированно обеспечен в любом случае.

Описанные методы забоя, ощипывания и разделки подходят как для обычных уток, так и для индоуток и диких птиц. Подходящий возраст для заготовки тушек может отличаться в зависимости от породы.

Рекомендации по уходу за молодняком

Через три недели после вылупления мулардиков можно переводить в сарай. При откорме на мясо эту птицу обычно держат напольным методом. Утром ее выпускают на выгул, а вечером загоняют обратно в сарай. Утки мулард, отзывы о которых отличные в том числе и из-за их неприхотливости, как и любая другая водоплавающая птица, очень любят купаться. Позволять им плавать и плескаться в установленных в выгуле емкостях, однако, можно только с двухмесячного возраста – после того как они полностью оперятся.

Кормить уток желательно 3 раза в день – утром, в обед и вечером. Забивают птицу в 2,5-3 месяца.

Подготовка перед забоем

Забой утки на мясо должен осуществляться после определённой подготовки:

  1. Посадить птицу, выбранную на убой, на голодную диету не менее, чем на 10–12 часов, чаще всего на ночь.
  2. Поместить особь в отдельное помещение, в котором весь период пребывания должен быть включён свет. Это необходимо для того, чтобы птица освободила кишечник.

Откорм на фуа-гра

Мы рассмотрели основную информацию о таких птицах, как утки муларды (выращивание в домашних условиях, отзывы). Мнение об этом гибриде хорошее не только потому, что у него вкусное мясо. Гурманами очень ценится и печень этой птицы. Из нее в ресторанах готовят особое блюдо, называемое фуа-гра. В особенности оно популярно во Франции. Но и в России это блюдо также ценится и является довольно-таки востребованным. Откорм уток мулардов для получения качественной печени производится по особой технологии.

В первые три недели жизни уход за птенцами осуществляют обычным способом. Затем птицу помещают в клетки, размер которых должен быть таким, чтобы она не могла много двигаться. Кормят подросший молодняк, выращиваемый на печень, пищей, содержащей очень большое количество протеинов и крахмала. Включают в рацион и специальные минеральные и витаминные добавки.

С 8-10-го дня жизни уток начинают кормить принудительно, проталкивая пищу в глотку с помощью специального шнека с трубкой. За день мулард, выращиваемый по такой технологии, должен получать не менее 1,8 кг зерна. Длится принудительный откорм обычно 12-21 день. При таком содержании печень у птицы вырастает в 10 раз больше обычных размеров. При этом она не теряет своих отличных вкусовых качеств.

Таким образом, утки породы мулард, отзывы о которых положительны в том числе и из-за их печени, – птица для разведения на самом деле очень выгодная. Конечно, содержание их по описанной выше технологии – процедура довольно сложная и может отнимать много времени. Однако все усилия при таком подходе к делу обычно вознаграждаются сторицей. Печень мулардов сдают в дорогие рестораны, и стоит она очень недешево.

Болезни

Крепкое здоровье – это также то, чем характеризуется домашняя утка мулард. Отзывы об этой породе хорошие в том числе и потому, что она очень устойчива к разного рода инфекциям. В этом плане каких-либо хлопот муларды своим хозяевам обычно не доставляют. Даже холод и серьезные перепады температур они переносят вполне спокойно.

Редко, но все же случается так, что эти утки заболевают аспергиллезом или клоацитом. В первом случае для лечения применяют раствор медного купороса (внутрь), во втором – йод и цинковую мазь.

разведение в домашних условиях, видео и отзывы

Содержание статьи

Разведением домашней птицы занимаются не только на промышленном уровне, во многих небольших хозяйствах содержат, кур, гусей, индюков. На особом месте стоят утки – их разводят из-за мяса, а также деликатесных качеств печени.

Следует обратить на породу этих водоплавающих птиц – Мулардов. Эти особи обладают высокой скороспелостью, а также прекрасными вкусовыми качествами печени. Поэтому Муларды сейчас потеснили породы гусей, выращиваемых «на печень» во многих больших фермерских хозяйствах.

Муларды, несмотря на свою популярность, вызывают множество вопросов у птицеводов: легко ли ухаживать, выгодно ли содержать, и стоит ли начинать выращивание и разведение Мулардов в своем хозяйстве? Многие птицеводы выращивают данный гибрид на продажу и утверждают, что бизнес на этих птицах очень выгоден.

Утки муларды – описание породы

Муларды – гибридная порода, получившаяся в результате селекционных работ с индоутками и пекинскими домашними (либо с другими породами). Некоторые продавцы могут утверждать, что от данного гибрида можно получить полноценное потомство. Однако это неверно – Муларды являются стерильной породой. Даже если самец этой породы и покроет самку, яйца все равно останутся стерильными, и потомства из них не выведется. Поэтому Мулардов не содержат для дальнейшего разведения.

На птицефабриках этих особей разводят на мясо и для получения деликатесной печени. Муларды быстро наращивают массу тела – за пару месяцев могут набирать около 4,5 кг вкусного мяса. При одинаковом рационе питания Муларды быстрее набирают вес, чем индоутки. Чтобы получить печень для фуа-гра, их сажают в тесные клетки и откармливают в принудительном порядке.

Окраска перьев Мулардов поражает разнообразием цветов. Обычно основной цвет перьев – темный, реже светлый с черным пятном на затылке, также встречаются Муларды с пестрой раскраской.

Отличить самцов от самок можно по окраске. Самки отличаются более тусклой расцветкой оперения, а селезни обладают более яркой и нарядной расцветкой. На шее селезней есть хохолок из длинных и более ярко раскрашенных перьев. Самцы имеют под клювом бородку, которая отсутствует у самок.

У «мужчин» размеры туловища крупнее, лоб – широкий, расширяющийся треугольником от основания клюва. Различить Мулардов можно по голосу – самки крякают, а самцы только шипят.

Характеристика взрослых особей

  • Масса тела зависит от возраста этих водоплавающих особей. В 8-10 недель масса уточек составляет около 3,5 кг. Между самками и самцами разница в массе составляет не более 0,5 кг.
  • При откармливании Мулардов «на печень» ее вес бывает не меньше, чем у гусей, которых также выращивают  на фуа-гра. Вкусовые качества утиной печени, по мнению птицеводов, замечательные и уже признаны деликатесным продуктом.
  • Мясо Мулардов – жирное, на вкус – нежнее и не имеет такого особого запаха, как гусиное.
  • На мясо данный гибрид не выращивают до того периода, когда они начинают откладывать яйца, а забивают раньше. И конкретных цифр яйценоскости Мулардов нет. Яички этих птиц стерильны, непригодны для дальнейшего разведения. Поэтому от этих уточек яйца не собирают.
  • Конкретное количество кормов для молодняка и взрослой птицы будет указано ниже. Но замечено — Муларды потребляют кормов столько же, сколько другие домашние птицы, но вот количество мяса при этом от данного вида получают больше.
  • Цена на мясо Мулардов не отличается от расценок на такую продукцию других пород уток.

[adinserter block=»6″]

[adinserter block=»10″]

Разведение Мулардов в домашних условиях

Для разведения этого гибрида в домашних условиях птицеводы предпочитают покупать утят и выращивать их до возраста, когда можно забивать подросший молодняк. Но ряд фермеров (для получения Мулардов) занимается в условиях своего подсобного хозяйства скрещиванием.

Как вывести породу самому?

Так как Муларды являются стерильными, у многих начинающих птицеводов возникает вопрос: как в домашних условиях вывести этот гибрид? Не сложно ли это делать?

Массовым разведением этих уток занимаются за рубежом, чтобы получать деликатесную печень. Но и в домашних условиях можно также успешно разводить этот гибрид, достаточно скрещивать самок индоуток с самцами пекинских уток (но можно скрещивать и наоборот).

При этом следует придерживаться ряда правил:

  • Спаривать самцов и самок следует в определенный период – с первой декады мая по последнюю декаду июня..
  • Для скрещивания следует брать Мулардов в возрасте 8-10 месяцев. В более раннем возрасте потомства может не получиться, у особей этого гибрида старше 11 месяцев яйца будут пустыми.
  • Для спаривания достаточно содержать одного самца в отдельном помещении, где находятся не более 5 самок. После того, как их поместили в отдельный загон, некоторое время Муларды будут привыкать к новым условиям содержания. И только потом следует ждать, что утки будут откладывать оплодотворенные яйца.
  • Часто селезни не проявляют активности к самкам белой окраски. Поэтому хозяева идут на хитрость – они окрашивают белое оперение на спинах пекинских самок темной краской.

Как получить потомство:

  • Чтобы получить потомство, под наседку кладут яйца, собранные в недельный срок. Если у хозяина есть хорошая утка-наседка, то можно не приобретать для выведения потомства инкубатор. Но при высиживании кладки наседкой процент выживаемости утят близок к 98-99%, у инкубаторных утят этот процент гораздо ниже – до 55-60%.
  • Тех самок-наседок, которые хорошо зарекомендовали себя как мамы, оставляют  в хозяйстве на несколько лет.
  • Гнездо под кладку обустраивают в тихом затемненном месте. Следует брать деревянный ящик достаточно большого размера, дно выстилается сеном. Одна утка в состоянии высидеть 13-15 яиц.
  • Через пару недель яйца в кладке исследуют с помощью овоскопа. Если внутри не обнаружены сосуды (либо зародыши не развиваются), такие яйца сразу убирают из гнезда.
  • Самка сходит с кладки два–три раза в день, чтобы принять пищу, а также занимается гигиеническими процедурами. Кормушка и поилка должны находиться поблизости от кладки.
  • Также следует поставить неподалеку тазик с водой, чтобы утки могли искупаться.
  • Возвращаясь в гнедо, наседка мокрыми перьями орошает яйца, что полезно для растущих зародышей. В инкубаторе также проводится регулярное орошение яиц. Потомство появляется на свет через 28 дней.

Как купить здоровых утят?

Приобретают утят Молардов у известных производителей или у знакомых продавцов с хорошими рекомендациями. По каким признакам определяют здорового птенца?

Основные симптомы здоровой птицы:

  • Прекрасный аппетит – утенок с жадностью готов есть практически без остановки;
  • Блестящие глаза, в их уголках не скапливаются слезы.
  • Под хвостом птенца – чисто и сухо, на животе нет следов влаги, пух равномерный по всему телу, нет проплешин, залысин и следов помета.
  • Также внимательно следует осмотреть крылья и конечности, чтобы не было вывиха или других дефектов.
  • Здоровый птенец – непоседлив и активен, а больной – неподвижно сидит в одной позе часами.

Желательно приобретать птенцов вместе с мамой, либо подсаживать в своем птичнике к наседке. В этом случае утята будут чувствовать себя в безопасности, а мама их обогреет и проследит.

Условия содержания

Разведение Мулардов в домашних условиях – насколько трудным может быть этот процесс? И какие условия нужны, чтобы этот гибрид чувствовал себя комфортно в домашних условиях?

Для этих уток следует создать определенные условия для разведения: помещение с определенными размерами, место для выгула и обеспечить правильный сбалансированный рацион питания. Обо всем этом следует рассказать подробнее.

[adinserter block=»1″]

[adinserter block=»9″]

Помещение для уток

Содержание Мулардов не слишком отличается от условий, в которых живут другие породы уток. Птичник должен быть достаточно просторным и закрытым, в нем водоплавающие обычно ночуют и комфортно себя чувствуют ненастной осенью или холодной зимой.

  • Размер домика для птиц должен быть из расчета на 3 особи – 1 м2 помещения.
  • Птичник должен быть сухим и защищенным от сквозняков.
  • Пол в помещении обычно делают выше уровня земли на 5-7 см, на полу настилают подстилку толстым слоем (до 10 см).
  • В качестве подстилки используется солома или сено.
  • Температура в помещении летом должна поддерживаться около 20-23⸰С, в зимний период желательно, чтобы она опускалась не ниже 3-5⸰С.
  • При необходимости в помещении устанавливают обогревательные приборы, которые должны быть ограждены от уток, а также лампы дневного света для продления светового дня в птичнике.
  • В птичнике должны быть не только установлены кормушки и поилки, но и достаточно большие емкости, в которых эти птицы будут купаться.
  • Разведение Мулардов предусматривает обязательное наличие чистой воды в поилках и емкостях, поэтому менять ее приходится не реже, чем раз в день.

Выгул

Для выгула этим уткам требуется много места, поэтому тесный дворик для разведения большого числа Мулардов не подойдет. На каждую особь должно приходиться не мене 1 м2 пространства в огороженном вольере. Но ограда для Мулардов делается только в исключительных случаях, так как такой гибрид не покидает пределы территории, на которой обитает.

Поблизости должен находиться небольшой пруд или другой водоем, где могли бы поплавать эти домашние птицы.

Кормление Мулардов

При разведении Мулардов особое внимание следует уделить питанию этих водоплавающих. Об основных нюансах рациона птенцов и взрослых особей, выращиваемых в домашних условиях, будет рассказано ниже.

Чем и как кормить утят?

Молодое поголовье, недавно вылупившееся из яиц или купленное на базаре, очень требовательно к пище, которую им дают.

С маленькими утятами приходится возиться отдельно, так как самостоятельно они принимать пищу не умеют. Каждого утенка приходится кормить отдельно.

Важно, чтобы в поилках всегда была свежая вода, так как эти особи в день выпивают до 3-4 литров жидкости. Поилки для уток должны быть большими в ширину, но неглубокими.

В первый день новорожденных малышей поят слабым раствором марганцовки. На следующий день их можно кормить любой кашей, в которую добавлены вареные яйца. С пятого дня в рацион малышей вводится тертая зелень, а с 14 дней в пищу птицам добавляют вареную картошку.

В специализированных магазинах всегда есть в наличии специальные сбалансированные корма для молодняка этого гибрида (с двухнедельного возраста и старше). А ветеринарные аптечные пункты всегда предложат наборы витаминов для потомства Мулардов разного возраста.

Кормление взрослых Мулардов

В рацион взрослых Мулардов обязательно должны входить следующие продукты:

  • Свежая трава (любая, кроме ядовитой), а также водные растения.
  • Овощи (морковь, картошка, тыква, капуста), Картошку можно давать только в отварном виде.
  • Отходы, включая и мясные (в небольших количествах).
  • Злаковые культуры (овес, ячмень, горох, фасоль, кукурузу).
  • Жмых.
  • Молочная продукция.

Летом Мулардов кормят 4-5 раз в день. Дважды в день им дают сухие и влажные корма. Также в рационе должна присутствовать трава.

Зимой этому гибриду достаточно двух приемов пищи: утром – сухие корма, вечером – влажную пищу, овощные культуры. Но в состав этой еды обязательно должны входить витамины.

Кормление несушек

Рацион несушек обычно хорошо сбалансирован в любом сезоне, в него должны входить сухие и влажные корма, овощи, зеленая трава, костная мука, жмых. Не следует забывать о том, что в зимнее время самок следует подкармливать витаминами.

Откорм Мулардов на фуа-гра

Чтобы получить жирную печень, Мулардов переводят на принудительную кормежку, уменьшая двигательную активность. Для откорма отбирают здоровых птенцов в возрасте 90 дней с массой тела не меньше 4 кг.

Откармливают на фуа-гра Мулардов интенсивно в течение 20-25 дней, при этом особи практически перестают двигаться, постоянно находятся в сонном состоянии, поэтому у них откладываются значительные запасы жира.

При этом норма корма в этот период увеличивается в несколько раз. Сами Муларды не в состоянии потреблять столько пищи, им обычно с помощью специальных приспособлений заталкивают корм в желудок.

[adinserter block=»8″]

Болезни уток при выращивании

Мулард при разведении в домашних условиях может прекрасно адаптироваться к разным условиям содержания, может не страдать от мороза, практически не подвержен инфекционным болезням. Но есть ряд заболеваний, от которых могут страдать эти водоплавающие.

Аспергиллез

Аспергиллез — грибковая болезнь, которая может попасть к Мулардам при вдыхании пыли от плохого корма или перепревшей подстилки.

Симптомы заболевания:

  • вялое состояние;
  • общая слабость;
  • ухудшение аппетита;
  • рвота;
  • дыхание учащается.

Если вовремя не начинается лечение, то наступает паралич крыльев и лапок. В запущенных случаях умирает не менее половины заболевших особей. Аспергиллез передается по наследству.

Выщипывание перьев

Часто особи этого гибрида при чистке перышек начинают их выдергивать. Это может сигнализировать, что Мулардам не хватает белковой пищи и витаминов. Если хозяева при разведении не соблюдают условий содержания, то это также может спровоцировать выщипывание перьев.

Тесный птичник, несоблюдение правил гигиены, отсутствие вентиляции приводят к более частому загрязнению оперения, поэтому Муларды вынуждены чаще чиститься.

[adinserter block=»2″]

Клоацит

Если при разведении Мулардов в их пище недостаточно витаминов А и Д, то может развиться это заболевание. Основной симптом – наличие воспаления слизистой оболочки клоаки.

Достоинства и недостатки

Как и у других пород, у Мулардов есть свои достоинства и недостатки, на которых следует остановиться подробнее.

Достоинства

 Недостатки
При разведении птицы в домашних условиях не требуется особых усилий.

Прекрасные вкусовые качества мяса и деликатесной печени.

Быстрый набор массы молодняком.

Муларды не требуют особого ухода, их содержание обходится гораздо дешевле, нежели обычных уток. Гибриды хорошо приспосабливаются к холодному и жаркому климату.

Подверженность некоторым заболеваниям неинфекционного характера.

Стерильность Мулардов.

Нельзя получить потомство. Поскольку муларды гибриды, от них нельзя получить молодняк, поэтому для выведения необходимо каждый раз скрещивать мускусную и пекинскую утку.

Заключение

Разводить мулардов в домашних условиях намного проще, чем обычную утку. Можно купить яйца и заложить в инкубатор или сразу же приобрести утят. За сезон легко вырастает полноценная утка, которую осенью уже можно резать. Мяса много и оно практически нежирное, резать лучше в 4 месяца, больше держать нет смысла, да и утка будет жесткой.

Отзывы

Отзывы о разведении уток Мулардов в домашних условиях:

муларды — разведение в домашнем птицеводстве, выращивание и кормление

Особенности и внешний вид птицы

Мулард – это порода, которая имеет свои внешние отличительные признаки. Что касается расцветки, представители могут быть желтыми с небольшими темными пятнами на хвосте или голове, а также коричневыми и черными с небольшим светлым оперением на животе.

Особенности птицеводства мулардов:

  • Количество уток на одного мускусного селезня – 3–5 шт.
  • В случае расхождения цвета оперения уток могут подкрашивать (например, создавать небольшие пятнышки на голове), что способствует лучшему сближению. Так как иногда селезень может не обращать внимания на представителей иного типа породы.
  • После того как были снесены яйца, должно пройти не менее 2 недель, прежде чем их забирают на инкубацию.
  • Срок сбора на инкубацию – не более 10 дней.
  • Молодняк выводится либо под наседками, либо в инкубаторах. Как наседку используют мускусную утку, к которой подкладывают от 10 до 20 яиц.
  • Важно при искусственной инкубации обеспечить достаточный уровень влажности. Для этого используется специальное оросительное оборудование.
  • Нормальный срок до выведения молодняка – 31 день.
Особенности птицеводства мулардов

Внимание! Использование мулардов для дальнейшего разведения птицы недопустимо. Этот вид, как и другие гибриды, бесплоден. 

Причем это касается как самцов, так и самок. То есть выращивать этот вид можно исключительно в пищевых и коммерческих целях, но не продолжать их разведение. Важно также отметить, что от обратного скрещивания возможно принесения мелких яиц (не более 50 граммов).

Созревают муларды до 3,5-4 кг. Для набора такого веса утке достаточно 9 недель содержания в фермерских условиях и 12 недель – в домашних. Муларды практически не отличаются по размеру между самцом и самкой. В тех случаях, когда мускусная утка скрещена с пекинским селезнем, разница в габаритах будет более заметной.

Ценность мяса муларда

Отличие между мясом обычной домашней утки и муларда разительное. Птицеводы хорошо знают, что у стандартных пород много жира. Мяса совсем мало, и оно, как правило, жесткое даже при длительной тепловой обработке. У мулардов же практически идеальное сочетание всех питательных свойств. Например, жирность их мяса не превышает 25% – это оптимальный показатель, в сравнении с пекинскими особями (35%).

При этом не требуется длительная термическая обработка. Мясо готовится довольно быстро и имеет высокие кулинарные показатели. Например, из этого продукта отлично получаются вкусные мясные блюда, например: отбивные, котлеты, запеканки и прочие.

Мясо мулардов можно:

  • жарить;
  • тушить;
  • варить;
  • подвергать обработке на открытом огне.

В результате получается высококачественное блюдо с отличными пищевыми свойствами. Также путем соблюдения специальной «диеты» предусматривается приготовление вкусной печени. Она считается деликатесом и может подаваться в люксовых заведениях общественного питания.

Ценность мяса муларда

Содержание птицы

Для разведения и содержания мулардов в птицеводстве используются довольно просторные помещения. К примеру, на 1 голову птицы приходится 0,35 м2 площади помещения, а на улице – не менее 1 м2. Для содержания выводка достаточно обеспечить пространство достаточным уровнем влажности и тепла.

При разведении мулардов целесообразно использовать специальные кормушки и автоматические поилки для уток.

Разведение уток-мулардов

Автоматические ниппельные поилки для уток SAGRADAНиппельная система поения SAGRADA обеспечивает непрерывное поступление чистой воды и создает все необходимые условия для поддержания здоровья уток и гусей.

Дата загрузки:2021-08-02

Автоматические ниппельные поилки для уток SAGRADA

Ниппельная система поения SAGRADA обеспечивает непрерывное поступление чистой воды и создает все необходимые условия для поддержания здоровья уток и гусей.

Забой

Важно помнить, что в идеале птицу необходимо забивать не позднее 60 суток отроду. В противном случае после 70 дней порода начинает терять вес, мясо, и шкура будут крайне плохо поддаваться обработке. После забоя рекомендуется окунать тушку в горячую воду (но не кипяток – до 70 °С). Тогда оперение легко счищается. Очень важно правильно обрабатывать продукт, так как в дальнейшем от этого зависит благосклонность покупателей. Также в большинстве случаев при разделывании тушки субпродукты продаются отдельно.

Прибыльность дела

Птицеводство мулардов может дать неплохую прибыль лишь при правильном содержании, а также немалом объеме. Несмотря на то, что процент выводка даже в инкубаторе довольно высок (порядка 60%), неправильное выращивание может испортить всю партию.

Современные технологии позволяют обеспечивать содержание птицы с максимальной эффективностью, потому стоит прибегать к инновациям для достижения оптимального результата!

Разведение уток-мулардов

Видео: утиная фермаУтиная ферма на 20 000 голов расположилась в здании 120 х 20 м. Для оснащения птицефермы было использовано следующее оборудование: бункер для хранения корма вместимостью 16 т. линия шнековой транспортировки корма длиной 24 м, которая подает корм на 3 линии кормления длиной 114 м. 4 линии поения длиной 114 м каждая.

Дата загрузки:2021-08-02

Видео: утиная ферма

Утиная ферма на 20 000 голов расположилась в здании 120 х 20 м.

Для оснащения птицефермы было использовано следующее оборудование:

  • бункер для хранения корма вместимостью 16 т.
  • линия шнековой транспортировки корма длиной 24 м, которая подает корм на 3 линии кормления длиной 114 м.
  • 4 линии поения длиной 114 м каждая.

FUD Mallard (6 шт.)

Greylag gese fullbody EVA 6 шт.

€ 89,95

Greylag gese fullbody EVA 12stk

€ 169,95

€ 25 скидка

Приманка для серого гуся 18шт

€ 149,85 € 124,85

Приманка для серого гуся 6шт

€ 49,95

Sillosocks Harvester Pack Canada

€ 117,50

Ветроуказатели Barnacle 12 шт.

€ 119,95

€ 5 скидка

Сумка для приманок на 12 слотов 031W

€ 37,50 € 32,50

Рюкзак Decoys 65 см x 100 см

9,95 €

Рюкзак Decoys 90 см x 125 см

14,95 €

Летящий голубь с шезлонгом

19,95 €

Flying Pigeon Decoys Mk 2

€ 69,95

Голубь-манка 30 см 12 штук

34,95 €

Кормление голубей 38 см

3,25 €

€ 1 скидка

Кормление голубей приманкой 33см

€ 7,95 € 6,95

€ 3 скидка

Приманка для голубей, полностью собранная, 36 см, 5 штук

€ 22,95 € 19,95

€ 10 скидка

Манок на голубя, полностью собранный, 36 см, 10 штук

€ 42,50 € 32,50

€ 15 скидка

Приманка для голубей, полностью собранная, 36 см, 20 штук

€ 89,95 € 74,95

€ 1 скидка

Приманка для летающих голубей

€ 9,95 € 8,95

€ 2 скидка

Манок на летающих голубей за 3 штуки

€ 27,95 € 25,95

€ 2 скидка

Летящий голубь 41см с флокированными крыльями из пены EVA

€ 12,95 € 10,95

€ 4 скидка

Летучий голубь 41см с флокированными крыльями из этиленвинилацетата 2 штуки

€ 21,90 € 17,90

Голуби-манки на 10 штук

32,95 €

Голуби-манки за 50 штук

145,00 €

€ 20 скидка

Панцирь серого гуся 5 шт.

€ 69,95 € 49,95

€ 20 скидка

Пестрый панцирь гуся 5 шт.

€ 69,95 € 49,95

Goose Flag SW Камуфляж

€ 19,95

Sillosocks канадский гусь нагула 3 штуки

€ 28,75

Sillosocks Pink Foot в стиле гуся, 3 штуки

€ 31,90

Sillosocks Розовые гусиные гуси для кормления 3 штуки

€ 28,75

Силлосок Canadian goose Flapper

€ 32,95

Sillosock Pink Foot Goose Flapper

€ 27,95

Sillosock Flying crow

26,95 €

Кормление ворон 39 см

5,95 €

Ворона смотрит вокруг 33 см

5,95 €

€ 5 скидка

Ворона-манок на 5 штук

€ 25,95 € 20,95

€ 15 скидка

Ворона-манок, стаями по 10 штук

€ 49,95 € 34,95

€ 13 скидка

Ворона-манок на 20 шт., Вкл.рюкзак

€ 82,95 € 69,95

Ворона со звуком

€ 24,95

€ 10 скидка

Ворона-манок на 36 штук

€ 125,00 € 115,00

Приманка для летающих ворон

7,95 €

Приманка для летающих ворон за 3 штуки

22,50 €

€ 3 скидка

Приманки для вороны, штабелируемые по 10 штук

32,95 € 29,95 €

€ 18 скидка

Приманки для ворон, штабелируемые по 36 штук

117,95 € 99,95 €

Колышки-ловушки Crow 10st.

€ 7,95

€ 2 скидка

Ворона

€ 17,95 € 15,95

€ 2 скидка

Ворона манок magnum flocked 50см

€ 17,95 € 15,95

€ 1 скидка

Приманка для вороны с капюшоном

€ 4,95 € 3,95

€ 1 скидка

Галка стекалась 32см

€ 7,75 € 6,75

€ 1 скидка

Приманка для сороки

€ 4,95 € 3,95

€ 10 скидка

Набор приманок DKwai Greylag Goose из 6 предметов в полный рост

€ 259,00 € 249,00

€ 10 скидка

Набор приманок DKwai Greylag Goose, 12 весов

€ 259,00 € 249,00

€ 10 скидка

Набор приманок для гуся DKwai Canada, 12 весов

€ 259,00 € 249,00

€ 10 скидка

DKwai Canada Goose набор приманок из 6 предметов в полный рост

€ 259,00 € 249,00

Сумка-приманка DK WAI

59,00 €

€ 15 скидка

Утка-манок стая 39 см по 8 штук

59,95 € 44,95 €

€ 3 скидка

Утка-манок со стаями 39 см

€ 8,95 € 5,95

€ 2 скидка

Шезлонг на 3 шт.

€ 29,95 € 27,95

€ 10 скидка

FUD Приманка для серого гуся (6 шт.)

€ 77,95 € 67,95

Крючок 5 шт.

17,95 €

FUD манок на белолобого гуся (6 шт.)

€ 69,95

€ 2 скидка

Морской гусь FUD (6 шт.)

€ 64,95 € 62,95

€ 2 скидка

Колышки-приманки 10 шт.

€ 9,95 € 7,95

Шезлонг гусиный / 3шт

32,95 €

FUD Канада гусь 6st

€ 69,95

€ 9 скидка

FUD Nile Goose (6 шт.)

€ 57,95 € 48,95

FUD Лесной голубь (6 шт.)

29,95 €

Белый гусь FUD 1 штука

10,95 €

€ 1 скидка

Держатель для голубя / ворона

€ 4,49 € 3,49

€ 20 скидка

Вышибала на 5 шт.

€ 64,95 € 44,95

€ 2 скидка

Сумка-переноска Decoy

€ 4,95 € 2,95

Крючок

3,95 €

Часто задаваемые вопросы | FWC

  • Какие именно виды уток охватывает это правило, поскольку большинство домашних уток происходит от кряквы?

    Положение (1) правила гласит:
    «Для целей этого раздела« кряква »включает всех Anas platyrhynchos и их плодовитые гибриды, за исключением белой разновидности Anas platyrhynchos, широко известной как« пекинские »утки.»

    Большинство домашних уток являются представителями Anas platyrhynchos domesticus, поэтому применяются все положения этого правила. Однако это правило не распространяется на пекинских уток, московских уток (Cairina moschata) или любых других видов, кроме Anas platyrhynchos. Проверить с продавцом или заводчиком перед покупкой любого сорта домашней утки.

  • Какие разрешения позволяют мне владеть кряквами во Флориде?

    Есть несколько разрешений (перечисленных на странице Разрешения на кряквы), которые позволяют вам владеть кряквами, включая бесплатное разрешение на личное домашнее животное.

  • Что делать, если у меня уже есть кряквы, и они на свободном выгуле на моем участке, являются ли они «дедушками»?

    Нет, это правило требует от всех, у кого есть кряквы, получать разрешение, и требует, чтобы кряквы содержались в клетках, как указано в правиле. (См. №5 ниже для получения информации о клетке)

  • Какие разрешения необходимы для складирования кормов и семян кряквы?

    Если в кормовом магазине есть / продаются только дикие птицы, необходима лицензия на игровую ферму по 372.16, Ф.С. Если в кормовом магазине хранятся / продаются дикие птицы и другие дикие животные, необходимо разрешение на выставку или продажу согласно 372.921, F.S.

  • Каковы требования к клеткам для крякв?

    Кряквы должны содержаться в клетках в соответствии с Правилом 68A-6.0023 и 68A-6.004, F.A.C. (Сюда входят конкретные размеры клеток и спецификации, основанные на количестве содержащихся уток, санитарных соображениях, предоставлении убежища и т. Д.).

    Кроме того, лица, кроме лиц, допущенных в соответствии с Правилом 68A-12.010, F.A.C. (Частные охотничьи заказники), должны соответствовать следующим требованиям:

    1. Все клетки и вольеры, содержащие способные к полету кряквы, должны быть закрыты сверху для предотвращения побега, и
    2. К востоку от округа Джефферсон клетки и вольеры с нелетающими кряквами должны быть закрыты сверху, чтобы предотвратить взаимодействие с дикими водоплавающими птицами.
  • У меня есть кряквы на заднем дворе / в пруду по соседству. Могу ли я взять этих крякв в неволи после получения разрешения на владение кряквами от FWC?

    Если рассматриваемые кряквы еще не находятся в вашем владении, но находятся на свободном выгуле, в соответствии с федеральным законом вы не можете брать их в неволи, если они не отмечены должным образом как выращенные в неволе.Федеральные правила (50 CFR 21.13) определяют выращенных в неволе крякв как тех, которые являются
    … физически маркированными по крайней мере одним из следующих методов до достижения 6-недельного возраста, и все такие утки, вылупившиеся, выращенные и оставленные в неволе после этого, должны иметь такую ​​отметку до достижения 6-недельного возраста. (1) Удаление заднего пальца правой ступни. (2) Зубчатое соединение крыла: при условии, что этот метод заключается в удалении пястных костей одного крыла или части пястных костей, что делает птицу навсегда неспособной к полету.(3) Бандажирование одной плюсны бесшовной металлической лентой. (4) Выделение легко различимой цифры, буквы или их комбинации на перепонке одной ступни. (c) При наличии такой маркировки такие живые птицы могут быть реализованы или приобретены у любого лица, а также владеть и передаваться в любом количестве в любое время и в любом месте: при условии, что все такие птицы должны быть физически маркированы перед продажей или удалением независимо от от того, достигли ли они возраста 6 недель.

  • Я живу за пределами штата, но хотел бы купить кряквы во Флориде, чтобы держать их в собственности в другом штате, нужно ли мне разрешение от FWC?

    Да, независимо от того, где вы живете или где находятся кряквы, вам необходимо разрешение от FWC, потому что вы будете владеть кряквами во Флориде.Отсутствие разрешения FWC при владении кряквами во Флориде является нарушением. Кроме того, если вы пересекаете границы штата без разрешения, это означает нарушение федерального законодательства (Закон Лейси, касающийся межгосударственной перевозки диких животных).

  • Я заинтересован в использовании крякв для полевых испытаний / дрессировки собак, как это правило влияет на меня?

    Согласно правилу ( FAC 68A-4.0052 ) разрешение не требуется для выпуска крякв для полевых испытаний.Однако для владения кряквами требуется разрешение. Доступна дополнительная информация о выпуске крякв для полевых испытаний ретриверов.

  • Я заинтересован в использовании крякв для тренировки соколов, как это новое правило повлияет на меня?

    Для владения кряквами требуется разрешение. Следовательно, вам понадобится любое из разрешений, перечисленных на странице разрешения кряквы, в дополнение к любому требуемому разрешению на соколиную охоту.

  • Птица для мелких фермеров: Путешествие в вечность

    В Интернете есть много полезной информации о птице, а также отличные книги для мелких птицеводов или птицеводов.(См. Ресурсы по птицеводству для мелких фермеров .) Вот некоторая полезная информация, которую вы, возможно, не так легко найдете.

    Московские утки
    Хаки Кэмпбелл утки
    Куры
    Гуси
    Кролики
    Цесарки
    Общие советы
    Высокопротеиновый корм для птицы из воздуха
    Птица как неоплачиваемый труд
    Они не домашние животные
    Делают это (убой)

    Московские утки


    Кит проводит время с BD (Big Duck)
    Первый выбор для небольших ферм и приусадебных участков.«Для действительно эффективного производства мяса в тропиках мы должны обратить внимание на московских уток», — говорит ECHO (Организация по вопросам образования в интересах голода). Не только в тропиках.

    «Мы начали с селезня и двух уток. Через восемь месяцев мы съели около 25 яиц и 45 уток разных размеров».

    Считается, что москвичи откладывают 195 яиц в год в течение 40-недельного сезона. Они будут гнездиться три или четыре раза за сезон, вылупляя до 20 утят за раз. У вас остается много яиц и МНОГО отличного мяса!

    Если вы никогда не ели Московию, знайте, что это действительно что-то.Московия совсем не жирная, как у других видов утиного мяса, это больше похоже на особую телятину, с прекрасной текстурой, очень небольшим количеством жира и неповторимым восхитительным вкусом. Это лучшая утка и, может быть, одно из лучших видов мяса.

    Москвичи уникальны, единственные домашние утки, не полученные от кряквы. Они родом из Южной Америки, и это древесные птицы, а не водоплавающие. Таким образом, им не нужен пруд для купания (им нужна вода, но подойдет и большой бассейн). И они летают.Они крупнее и тяжелее других уток, а полет дает им большие и мощные грудные мышцы и сильные мясистые ноги. Московская грудка похожа на солидный бифштекс, не догадаешься, это была утка.


    Московские утки — хорошие матери — маленькие коричневые — это хаки Кэмпбеллы, выведенные Московией (Кейт Аддисон)
    Для производителя они дешевы и беспроблемны: москвичи более-менее производят сами. Они самостоятельны, лучше собирают пищу, чем другие утки, быстро растут и редко болеют.Они убирают за другим вашим скотом, поедая то, что другие проливают или оставляют.

    Они представительны и умны, приятны, чтобы их было рядом, и они тихие: они не крякают, утки тихонько щебечут, а селезни шипят, и только когда им нужно — они не болтуны, как гуси, или шоуменов вроде петухов. Спокойные птицы. И хотя они летают, они летают вокруг, а не прочь.

    Они бывают черного и белого цветов и различных оттенков серого и коричневого, с ярко-красным гребнем вокруг глаз и над клювом, как петушиный гребень.Московии никогда не были индустриализированы или «развиты», вероятно, потому, что они не бывают стандартных размеров: селезни намного крупнее уток. Взрослый селезень весит около 15 фунтов, а утка — до 9-10 фунтов.

    Начните с селезня и трех уток. Московские куры могут закладывать три или четыре раза в год с кладкой от восьми до 20 яиц. Яйца вылупляются через 35 дней, птицы достигают полного размера за 120 дней, но могут быть забиты через 90 дней. Выход мяса выше, чем у любой другой утки: грудка на 50% больше, нежирная на 98%, а в шкуре на 50% меньше жира, чем у других уток (но забой в Московии все равно даст банку прекрасного утиного жира для приготовления) .

    Говорят, что в Москве меньше жира, потому что они родом из жаркого климата и им не нужен жир, чтобы согреться. Странно, что в умеренные зимы производят теплый жилет из тонкого пуха (полезный побочный продукт). У нас были москвичи с температурой до -15 градусов по Цельсию, и они совсем не возражали. Выносливые птицы.

    Moscovy Ducks — Хорошая информация и содержательная и развлекательная статья от Клуба домашних водоплавающих птиц Великобритании (да, у москвичей действительно отличное чувство юмора!):
    http: // www.domestic-waterfowl.co.uk/mozzie.htm

    Muscovy Ducks — Техническая записка ECHO, Исследовательского центра птицеводства, Папуа-Новая Гвинея. Несколько хороших общих советов, за исключением того, что утят не нужно отделять от матери — московские утки — отличные матери. Даже утят без матерей можно оставить гулять вместе на улице в достаточной безопасности (впрочем, никаких собак и кошек). Они такие же разумные звери, как и их мамы. Им не нужно много кормления, все москвичи умеют добывать себе пищу и заботиться о себе.Московиям не нужно столько заботы и управления, как предполагается в этой статье.
    http://www.echotech.org/mambo/images/DocMan/MuscovyD.PDF

    Московские утки — Глава 9 из «Микро животноводство: малоизвестные мелкие животные с многообещающим экономическим будущим» , 1991, Board on Наука и технология. Прочтите его онлайн (бесплатно) или распечатайте в прессе Национальной академии:
    http://books.nap.edu/books/0305X/html/125.html

    Домашняя кулинария от HGTV — Московская утка с Бургундский и клюквенный соус, на две порции:
    http: // www.hgtv.com/hgtv/ah_recipes_sauce_dressing/
    статья / 0,, HGTV_3194_1383740,00.html

    Утки Кэмпбелл цвета хаки

    Названы Кэмпбеллами, потому что они были разработаны миссис Адель Кэмпбелл в Великобритании сто лет назад, и они цвета хаки или темнее, как какао, с зелеными клювами, а у селезней темно-зеленые головы и бронзовые спина и хвост. Очень милые утки.

    Адель смешала индийских бегунов, крякв и руанских уток в поисках машины для яйцекладки, и в этом преуспела.

    Есть некоторые породы кур, которые могут стоить хаки Кэмпбелла, но они, вероятно, узкоспециализированные птицы и могут доставить больше хлопот, чем они того стоят. Хаки Кэмпбеллы вообще не проблема — они выносливые и хорошие собиратели. Они откладывают 300 яиц в год или больше — до 340. И они съедят всех слизней и улиток в вашем саду, и очистят пруд от комаров. Хорошая дворовая утка.

    «Способен сидеть и высиживать собственные яйца», — говорится в одной ссылке — нет, это не так! Это то, чего Адель добилась с ними — они не впадают в задумчивость и поэтому откладывают так много яиц.Мы только однажды видели, как Хаки Кэмпбелл впадает в задумчивость. Она волновалась, много крякала и суетилась в зарослях, пытаясь свить гнездо, но через несколько минут сдалась и вместо этого пошла купаться, выглядя немного озадаченной и слегка смущенной.

    Чтобы получить больше хаки Кэмпбелла, положите несколько яиц под гнездящуюся Московию. Московия их высиживает, а за утятами ухаживает сама. Курица тоже может это сделать.

    Индийские бегуны также являются хорошими несушками. Оба типа хороши для еды, а производство мяса будет хорошим, если вылупить яйца под Москвой.

    Пруд для уток не нужен, но тем лучше, если он у вас есть. Подойдет даже затонувшая ванна, но убедитесь, что у нее неглубокий конец, чтобы утята могли снова выбраться, иначе они могут утонуть. Не позволяйте утятам плавать, пока им не исполнится несколько дней.

    Khaki Campbell Duck — Общая информация с сайта Poultry Breeds в Университете штата Оклахома:
    http://www.ansi.okstate.edu/poultry/ducks/khakicampbell/index.htm

    Куры


    Петух в Мирном саду, Лантау (Кейт Эддисон)
    Если до сих пор вы ели только промышленных цыплят, то вы действительно не знаете, каков вкус курицы.Настоящая курица на свободном выгуле из органического приусадебного участка или птица на заднем дворе, выращенная на обрезках и царапинах, совсем другое дело — вы будете поражены! И в восторге.

    Куры необходимы на фермах любого размера и являются идеальной птицей в условиях ограниченного пространства. Они царапают — один раз, два — острые глаза выявляют маленьких жуков и крошечные семена сорняков, клюв опускается вниз. Постарайтесь устроить так, чтобы цыплята каждый сезон работали на всем вашем участке вместе с утками.

    Куры дают вам мясо и яйца, они смешивают, измельчают и удобряют ваш компостный материал для вас, они не представляют больших проблем (хотя и больше, чем утки и гуси), и они прячутся на ночь.Вам не нужен петух, чтобы иметь яйца, но он вам нужен, если вы хотите их разводить. Цыплята деловито кудахтают и визжат, если напуганы.


    Цыплята в тихом саду, Лантау
    Петухи шумные — не верьте, что они кукарекают только на рассвете! Но к этому привыкаешь.

    Держите кур на несушку, ешьте лишних петушков — петухи дерутся, хватит и одного.

    Пород кур очень много — выбирайте то, что наиболее распространено в вашем районе.Попробуйте хорошую, универсальную птицу общего назначения. Род-Айленд Редс и Плимут-Рокс — куры общего назначения. Леггорны яичные несушки, корниш — мясные. Бантамки — это удобно маленькие и хорошие ловцы насекомых, а также хорошие сеттеры — вы можете высиживать яйца других птиц под бантами.

    Ковчеги для выпаса — хорошие образцы здесь:
    Прибыльное производство птицы MG Kains, 1910

    … и здесь (см. Главу 5. Птица и пчелы):
    Handy Farm Devices and How to Make Them by Rolfe Cobleigh, 1910

    Гуси

    Строгие вегетарианцы, отличные газонокосилки, отличные сторожевые псы, умные, индивидуалистичные и самоуверенные, общительные, хорошие собеседники.Гуси — это здорово, если у вас есть комната: приличного размера лужайка или небольшой луг, да и пруд помогает, но это не обязательно. С ними очень мало проблем, они могут получать большую часть еды или всю пищу на пастбищах, и они помогают бороться с сорняками. Один из самых эффективных производителей мяса.

    Накормите их дополнительно, если вы их разводите. Одно гусиное яйцо — еда на двоих. В диком состоянии гуси — одно из немногих существ, спаривающихся на всю жизнь. В домашних стадах они более беспорядочные.

    Первые два яйца бесплодны, уберите их и приготовьте.Вы получите больше гусей, если положите первую партию яиц под высиживаемую Московию, тогда гусь откладывает вторую партию. Гуси кладут обычно 20 недель в году, начиная с весны. Китайские гуси откладывают до 100 яиц за сезон.

    Использование гусей для борьбы с сорняками — Гуси не уплотняют почву, как тяжелая техника или люди. Они будут работать семь дней в неделю, в любую погоду. Их можно помещать на влажные поля для работы, когда техника может увязнуть и нанести серьезный ущерб структуре почвы.Их подвижные шеи позволяют им вырывать сорняки близко и изнутри сельскохозяйственных культур, где машины или мотыга не могут. В конце сезона производитель также может переработать гусей на мясо и перья. Все это происходит, когда гуси естественным образом разбрасывают богатый азотом навоз по всему полю. — Статья объемом 3000 слов, Metzer Farms, Калифорния.
    http://www.metzerfarms.com/weeder.htm

    Прополка гусями , Гленн Гейгер и Гарольд Бильер, Департамент зоотехники, Университет Миссури-Колумбия — Почему гуси с удовольствием едят определенные растения, в то время как не проявляя никакого интереса к другим? Возможно, только гусь знает ответ.Правильное использование гусей может практически избавить от необходимости рыхлить траву и сорняки. Заменяется дорогой ручной труд. Экспериментальная сельскохозяйственная станция Университета Теннесси сообщает, что использование гусей на хлопковых полях может сэкономить 35 или более долларов на акре. Статья объемом 1600 слов.
    http://muextension.missouri.edu/xplor/agguides/poultry/g08922.htm


    Кролики на пастбище на ферме Фрогдич, Англия, 1986 (Кейт Аддисон)
    Кролики

    Кролики размножаются как кролики.Они размножаются круглый год, а период беременности составляет всего месяц или меньше — скоро у вас будет много кроликов. От одного доллара до 10 достаточно, но вы должны держать их отдельно. Вы также должны держать деньги отдельно: кролики дерутся. И зарываются под забором. Свободного выгула нет, но пастбища работают хорошо. Хорошая мясная продукция, но не безотказная. Если у вас есть дети, они сделают за вас работу — дети любят кроликов. Трава, сено, овощные обрезки.

    Начните с одного оленя и двух — и у вас будет крольчатина круглый год.Для разведения возьмите лань на самотек, иначе они, вероятно, будут драться. Оставьте их вместе на два дня, а затем верните ее обратно через 12 дней. Если она отказывается спариваться, значит, это сработало в последний раз, и она беременна. Оставьте ее с младенцами на шесть недель, а через две недели спаривайте снова. Другими словами, она будет размножаться четыре раза в год.

    Кроличий навоз качественный, удобный в обращении.

    Цесарка

    Цесарка — универсальный актив в небольшом хозяйстве.Единственный недостаток — это странный и шумный звук, который они издают — и даже это преимущество, потому что они лучше сторожевые псы, чем сторожевые псы (как гуси). И привыкаешь к ряду. Цесарки нуждаются в очень небольшом уходе — просто оставьте их в покое, они делают то, что хотят, кормятся сами, ухаживают за собой и откладывают самые лучшие яйца. Маленькое, но сытное и вкусное! — как и положено, выращенные на богатой и разнообразной диете из насекомых и семян сорняков. Они эффективно подавляют вредителей. Цесарки — лучший способ избавиться от клещей.

    Цесарки для борьбы с клещами — «На второй год пребывания здесь мы купили несколько цесарок. С тех пор клещи в нашей жизни стали очень редкими». Хорошие базовые советы по содержанию цесарок на свободном выгуле.
    http://www.countrysidemag.com/issues/3_1998.htm#Tick%20Control

    Общие советы

    Рассыпание древесной золы на полу курятника под насестами — хороший способ борьбы с пометом. Куриный помет и древесная зола вступают в реакцию, вытесняя азот и высушивая навоз, образуя удобные в обращении, удобные для хранения органические удобрения, богатые калием и фосфором.(Как и все «удобрения», вы получите лучший эффект, добавив их в компостную кучу, а не в почву.)

    Разложите тип «коричневых», которые вы используете для компостирования в птичнике — мертвые листья, испорченное сено, солома, опилки, измельченные газеты и картон, щепа. Сверху бросайте съедобные обрезки с огорода и с кухни. Цыплята будут царапать его, удобрять и тщательно перемешивать за вас — когда он будет готов, положите его прямо в мусорное ведро для компоста.

    Вермикомпостирование с красными червями имеет дополнительный смысл, если у вас есть домашняя птица.Черви содержат большое количество белка (лучше, чем говядина) и являются отличным кормом для живой (или сушеной) птицы. Популяция червей удваивается по крайней мере за шесть недель, и они съедают свой вес компостного материала в день. Нетрудно представить это так, чтобы у вашей птицы был хороший запас лишних червей. См. Вермикомпостирование .

    См. «Друг дождевой червь: практическое применение изучения привычек самого важного животного в мире на протяжении всей жизни» Джордж Шеффилд Оливер, 1941 год. Доктор Оливер был одним из первых, кто использовал дождевого червя для нужд фермера. и садовник, создавая высокоплодородный верхний слой почвы для оптимального роста сельскохозяйственных культур и производя постоянные поставки дешевого, высококачественного живого протеина для кормления домашней птицы.Он разработал простые, но элегантные и эффективные системы, позволяющие снизить затраты и рабочую силу, а также повысить производительность, чтобы помочь бедствующим фермерам сводить концы с концами. Полный текст на сайте Journey to Forever Small Farms Library .

    Корм ​​для птицы с высоким содержанием белка из воздуха

    Вокруг много мух? Соберите немного кухонных помоев — воду для приготовления пищи, соки и остатки мясных и рыбных блюд, немного молока: все, что станет действительно гнилостным, если вы оставите его на некоторое время. Затем оставьте это на некоторое время.Когда он очень сильно воняет, соберите немного компоста, скажем, 4-5 кубических футов, разложите его на солнце и сбрызните гнилостной кухонной жидкостью. Не мочите его слишком сильно — немного больше, чем должен быть компост.

    Вскоре он будет кишеть мухами. Подождите, пока не убедитесь, что у многих мух было достаточно возможностей отложить яйца. Затем зачерпните все это, положите в двойной мешок для мусора (один внутри другого), поместите пакет в картонную коробку подходящего размера и слегка закройте пакет.Он скоро перестанет пахнуть. Проверяйте это каждый день.

    Примерно через неделю вы откроете его и обнаружите, что поверхность плоская, мелко разделенная, слегка или даже значительно извивающаяся с личинками, множеством личинок. Пришло время, не позволяйте им превращаться в мух. Два варианта:

    Вариант 1
    Просейте его круглым садовым ситом с размером ячеек 3/16 дюйма (лучше всего — сетка из нержавеющей стали). В результате вы получите кучу хорошего черного компоста и сито, полное личинок — — первоклассные корма для птицы.Ваши куры, утки, цесарки подумают, что сейчас Рождество. Гуси, которые являются строгими вегетарианцами, будут потрясены и возмущены всем этим, но неважно. Положите просеивания в контейнер для компоста или в контейнер для червяков. Личинки, кстати, скорее помогают, чем мешают процессу компостирования. И, как бы отвратительно они ни выглядели, личинки-мухи не распространяют болезни.

    Вариант 2
    Позвольте птицам просеивать за вас, но не бросайте его на подстилку или мульчу во время бега, потому что они упустят несколько личинок, и из них вылупятся мухи.На голой земле они точно все получат.

    Вы только что уничтожили целое поколение мух.

    Вместо того, чтобы использовать жидкости, вы можете позволить нескольким литрам кухонных отходов полностью разложиться в ведре с крышкой и использовать это вместо этого.

    См. The Housefly профессора Роя Хартенштейна, онлайн на сайте Journey to Forever Small Farms Library .

    Заставляем муху Bluebottle работать — из книги Джорджа Шеффилда Оливера «Практическое применение изучения привычек самого важного животного в мире» Джорджа Шеффилда Оливера, 1941 г., онлайн на сайте Journey to Forever Small Farms Библиотека .

    Птица как неоплачиваемый труд

    Если вы держите московских уток (а вам стоит!), Может не хватить мух, чтобы собрать для вас коробку личинок.

    Канадское исследование борьбы с мухами с молочными телятами показало, что в Москве поймано в 30 раз больше домашних мух, чем на коммерческие мухоловки, наживки или мухобойку. Утки также ели пролитый корм, поэтому мухи не могли в нем размножаться.

    The Heifer Project Exchange цитирует одного рабочего из Того в Африке, который сообщил, что местных жителей не беспокоят мухи, потому что их московские утки убили их всех.Они зарезали несколько уток, вскрыли посевы, чтобы посмотреть, что они ели, и в каждой из них было полно сотен мух. (ECHO)

    Слизни и улитки едят вашу салатную зелень? Древние предания говорят: «Не бывает избытка слизней, просто нехватка уток».

    В частности, утки хаки Кэмпбелл, а также индийские бегуны, хотя все утки — отличные ловцы слизней, они даже охотятся за своими яйцами в почве. А вот утки тоже могут оценить вашу зелень для салата, так что вам придется понаблюдать за ними.

    Они не домашние животные

    Вы можете очень полюбить этих птиц. На ранней стадии различайте птиц для разведения и птиц для еды: вы можете давать имена заводчикам, но НЕ НАЗЫВАЙТЕ имена мясных птиц и не позволяйте им слишком сильно вас очаровывать. Не забывай, какая судьба тебе уготована!

    Дети могут принять это, если вы с самого начала полностью честны и откровенны. Не эвфемизируйте.

    Если вы их не съедите, они выведут вас из дома и дома.Если вы не можете вынести мысли об их убийстве, не позволяйте им размножаться, просто заберите все яйца. Или попросите кого-нибудь сделать это за вас. Вы можете научиться убивать животных из книги, хотя лучше попросить кого-нибудь показать вам.

    Делаем это

    — «Ты знаешь, как убить курицу?» — спросила бабушка Чой. «Конечно, знаю», — ответил Кит. «Вы берете его за голову и отрубаете ему тело».

    Обезглавливание, вероятно, лучший способ, особенно для новичков.Перерезание им глотки работает хорошо, и, вероятно, так же быстро. Рефлекторные взмахи мешают обоим этим способам. Самый простой способ — свернуть (сломать) им шеи, но для того, чтобы сделать это правильно, нужна практика, и это грубо для птиц, пока вы поднимаетесь по кривой обучения. Может быть, вы знаете кого-нибудь, кто покажет вам, как это сделать.

    Убивайте птиц подальше от остальной стаи, убирайте их по одной — не заставляйте их ждать в очереди из-за того, что, как они знают, должно произойти.

    Головка
    Используйте тесак, чем тяжелее, тем лучше, и сохраняйте его острым.Используйте большой и тяжелый кусок дерева в качестве рубки. Забейте в нее гвоздь с одного конца. Привяжите к гвоздю короткую тонкую веревку, а на другом конце проденьте петлю. Уложите птицу спиной на блок, накиньте петлю на шею и затяните — не слишком туго. Возьмите птицу за ноги и оторвите от гвоздя, чтобы она не двигалась и не растягивалась. Если немного погладить его грудь и издать нежные успокаивающие звуки, он расслабится и, вероятно, закроет глаза. Теперь твой шанс. Нужен единичный, быстрый, меткий и решительный удар.Держитесь за ноги, держите птицу подальше от себя, пока рефлекторные взмахи не прекратятся.

    Горло
    Используйте острый нож с длинным лезвием (без зубцов). Возьмите птицу за ноги и дайте ей немного повиснуть вверх ногами. Скоро успокоится и расслабится. Затем повесьте его на столб или поручень на высоте около 6 футов от земли. Привяжите к поручню тонкую веревку и несколько раз обмотайте ею лапки птицы. Закрепить можно короткой палкой, привязанной к веревке, заправив палку между ног.Крепко, но осторожно возьмитесь за голову одной рукой и прорежьте горло примерно на дюйм ниже головы одним сильным широким ударом. Сделайте шаг назад и подождите, пока он перестанет хлопать.

    Выщипывание
    Окуните тушу в горячую воду, чтобы растрепать перья — не слишком жарко, иначе вы обожжете ее, и кожа порвется. Если есть пух, соберите птицу на столе и соберите пух пылесосом. Сделайте компост для перьев. Субпродукты в компостную корзину или свинью. Другой вариант — снять шкуру с птицы, перьев и прочего.

    См. Также:
    Обработка птицы в домашних условиях , Техасский университет A&M — 12-страничное иллюстрированное пошаговое руководство, оборудование и оборудование, разделка, потрошение, охлаждение и упаковка, снятие шкуры в Нью-Йорке. Загрузите PDF:
    http://gallus.tamu.edu/Extension%20publications/b-1383.pdf

    Домашняя переработка птицы , Мелвин Л. Хамре, Расширение Университета Миннесоты — Краткое иллюстрированное руководство: выбор птицы для убоя , перерабатывающие предприятия и оборудование, убой и разделка, потрошение, охлаждение и упаковка, разделка бройлеров или фритюрниц, разделка туш целиком
    http: // www.extension. ресурсы фермы
    Фермы, поддерживаемые сообществом
    Фермы с деревьями
    Фермы с животными
    Пастбища
    Свиньи для малых ферм
    Птица для малых ферм
    Аквакультура для малых ферм
    Компостирование для малых ферм
    Борьба с сорняками и вредителями

    Библиотека малых ферм


    Городские фермы Органическое садоводство
    Создание сада в квадратных футах
    Указатели расстояния между растениями
    Нет земли? Используйте контейнеры
    Когда что сеять
    Семена
    Садовый пруд
    Ресурсы для садоводства Компостирование
    Создание компоста
    Ресурсы для компостирования
    Компостирование в помещении
    Вермикомпостирование
    Humanure
    Компостирование для небольших ферм

    Сходство бактериальной микробиоты между хищниками и трофейной сетью

  • 1.

    Хупер Л.В., Брай Л., Фальк П.Г., Гордон Дж. Симбиоз хозяина-микроба в кишечнике млекопитающих: изучение внутренней экосистемы. BioEssays. 1998. 20: 336–43.

    CAS PubMed Google Scholar

  • 2.

    Mazmanian SK, Liu CH, Tzianabos AO, Kasper DL. Иммуномодулирующая молекула симбиотических бактерий направляет созревание иммунной системы хозяина. Клетка. 2005; 122: 107–18.

    CAS PubMed Google Scholar

  • 3.

    Chung H, Pamp SJ, Hill JA, Surana NK, Edelman SM, Troy EB, et al. Созревание иммунитета кишечника зависит от колонизации специфической микробиотой хозяина. Клетка. 2012; 149: 1578–93.

    CAS PubMed PubMed Central Google Scholar

  • 4.

    Heijtz RD, Wang S, Anuar F, Qian Y, Bjorkholm B, Samuelsson A, et al. Нормальная микробиота кишечника регулирует развитие и поведение мозга. Proc Natl Acad Sci USA. 2011; 108: 3047–52.

    CAS Google Scholar

  • 5.

    Эрни Д., де Анжелис А.Л., Джайтин Д., Вигхофер П., Сташевский О., Дэвид Е. и др. Микробиота хозяина постоянно контролирует созревание и функцию микроглии в ЦНС. Nat Neurosci. 2015; 18: 965–77.

    CAS PubMed PubMed Central Google Scholar

  • 6. ​​

    ван дер Ваай Д. Экология кишечника человека и ее последствия для чрезмерного роста патогенными микроорганизмами, такими как Clostridium difficile. Annu Rev Microbiol. 1989. 43: 69–87.

    PubMed Google Scholar

  • 7.

    Динан Т.Г., Стиллинг Р.М., Стэнтон С., Крайан Дж. Ф. Коллективное бессознательное: как кишечные микробы формируют поведение человека. J Psychiatr Res. 2015; 63: 1–9.

    PubMed Google Scholar

  • 8.

    Hird SM. Эволюционной биологии нужны дикие микробиомы. Front Microbiol. 2017; 8: 1–10.

    Google Scholar

  • 9.

    Scupham AJ, Patton TG, Bent E, Bayles DO. Сравнение микробиоты слепой кишки домашних и диких индеек. Micro Ecol. 2008. 56: 322–31.

    Google Scholar

  • 10.

    Гудрич Дж. К., Давенпорт ER, Уотерс Дж. Л., Кларк АГ, Лей РЭ. Межвидовые сравнения генетических ассоциаций хозяина с микробиомом. Наука. 2016; 352: 532–5.

    CAS PubMed PubMed Central Google Scholar

  • 11.

    Hird SM, Carstens BC, Cardiff SW, Dittmann DL, Brumfield RT. Место отбора проб более заметно, чем таксономия или экология, в микробиоте кишечника коричневоголовой коровьей птицы, паразитирующей на выводках ( Molothrus ater ). PeerJ. 2014; 2: 1–21.

    Google Scholar

  • 12.

    Бенсон А.К., Келли С.А., Легге Р., Ма Ф., Лоу С.Дж., Ким Дж. И др. Индивидуальность в составе микробиоты кишечника — это сложный полигенный признак, сформированный множеством факторов окружающей среды и генетических факторов хозяина.Proc Natl Acad Sci. 2019; 107: 18933–8.

    Google Scholar

  • 13.

    Мусителли Ф., Амброзини Р., Руболини Д., Сайно Н., Францетти А., Гандольфи И. Микробиота клоак амбарных ласточек из Северной Италии. Ethol Ecol Evol. 2018; 30: 362–72.

    Google Scholar

  • 14.

    Muegge BD, Kuczynski J, Knights D, Clemente JC, González A, Fontana L, et al. Диета способствует сближению функций микробиома кишечника в филогенезе млекопитающих и в организме человека.Наука. 2011; 332: 970–4.

    CAS PubMed PubMed Central Google Scholar

  • 15.

    Hird SM, Sánchez C, Carstens BC, Brumfield RT. Сравнительная микробиота кишечника 59 видов неотропических птиц. Front Microbiol. 2015; 6: 1403.

    PubMed PubMed Central Google Scholar

  • 16.

    Били М., Кортезеро А.М., Мугель С., Готье Дж. П., Эрмель Дж., Саймон Дж. К. и др. Разнообразие бактериального сообщества, обеспечиваемое взаимодействующими видами.PLoS One. 2016; 11: 1–23.

    Google Scholar

  • 17.

    Sugio A, Dubreuil G, Giron D, Simon J. Взаимодействие растений и насекомых под бактериальным влиянием: экологические последствия и лежащие в основе механизмы. J Exp Bot. 2015; 66: 467–78.

    CAS PubMed Google Scholar

  • 18.

    Hannula SE, Zhu F, Heinen R, Bezemer TM. Внекорневые насекомые приобретают микробиомы из почвы, а не растения-хозяина.Nat Commun. 2019; 10: 1–9.

    CAS Google Scholar

  • 19.

    White J, Mirleau P, Danchin E, Mulard H, Hatch SA, Heeb P, et al. Бактерии, передающиеся половым путем, поражают клоаки самок у дикой птицы. Ecol Lett. 2010; 13: 1515–24.

    PubMed PubMed Central Google Scholar

  • 20.

    Schlechter RO, Miebach M, Remus-Emsermann MNP. Движущие факторы эпифитных бактериальных сообществ: обзор.J Adv Res. 2019; 19: 57–65.

    CAS PubMed PubMed Central Google Scholar

  • 21.

    Remus-Emsermann MNP, Lücker S, Müller DB, Potthoff E, Daims H, Vorholt JA. Анализ пространственного распределения естественных колонизирующих филлосферу бактерий на Arabidopsis thaliana , выявленный флуоресцентной гибридизацией in situ. Environ Microbiol. 2014; 16: 2329–40.

    CAS PubMed Google Scholar

  • 22.

    Remus-Emsermann MNP, Tecon R, Kowalchuk GA, Leveau JHJ. Вариация локальной емкости и индивидуальной судьбы бактериальных колонизаторов в филлосфере. ISME J. 2012; 6: 756–65.

    CAS PubMed PubMed Central Google Scholar

  • 23.

    Роджерс Т.Дж., Леппанен С., Браун В., Фордайс Дж. А., Лебуд А., Ранни Т. и др. Изучение изменений микробных сообществ филлосферы у четырех видов болиголов. Экосфера. 2018; 9: 1–11.

    Google Scholar

  • 24.

    Редфорд А.Дж., Бауэрс Р.М., Найт Р., Линхарт Ю., Фирер Н. Экология филлосферы: географическая и филогенетическая изменчивость в распределении бактерий на листьях деревьев. Environ Microbiol. 2010; 12: 2885–93.

    PubMed PubMed Central Google Scholar

  • 25.

    Laforest-Lapointe I, Messier C, Kembel SW. Идентичность видов хозяев, место и время определяют структуру бактериального сообщества древесных филлосфер умеренного климата.Микробиом. 2016; 4: 1–10.

    Google Scholar

  • 26.

    Kembel SW, Mueller RC. Признаки растений и таксономия определяют ассоциации хозяев в грибных сообществах тропической филлосферы. Ботаника. 2014; 92: 303–11.

    Google Scholar

  • 27.

    Appel MH. Просвет кишечника жевательных травоядных животных: физико-химические условия и их влияние на питательные вещества растений, аллелохимические вещества и патогены насекомых.В: Бернейс Э.А. (ред.). Взаимодействие насекомых и растений , 1-е изд. 1994. CRC Press, Boca Raton, pp 209–23.

  • 28.

    Шеннон А.Л., Аттвуд Дж., Хопкрофт Д.Х., Кристеллер Дж. Т.. Характеристика молочнокислых бактерий средней кишки личинок кератинофага чешуекрылых, Hofmannophila pseudospretella . Lett Appl Microbiol. 2001; 32: 36–41.

    CAS PubMed Google Scholar

  • 29.

    Кукал О., Доусон Т.Э., Кукал О., Доусон Т.Э.Температура и качество пищи влияют на пищевое поведение, эффективность ассимиляции и скорость роста гусениц арктического шерстистого медведя. Oecologia. 1989. 79: 526–32.

    PubMed Google Scholar

  • 30.

    Виланова С., Байшерас Дж., Латорре А., Поркар М. Универсальный специалист изнутри: в кишечных бактериальных сообществах двух видов насекомых, питающихся токсичными растениями, преобладают Enterococcus sp. Front Microbiol. 2016; 7: 1–8.

    Google Scholar

  • 31.

    Priya NG, Ojha A, Kajla MK, Raj A, Rajagopal R. Растение-хозяин индуцировало вариации кишечных бактерий у Helicoverpa armigera . PLoS One. 2012; 7: 1–10.

    Google Scholar

  • 32.

    Jones AG, Mason CJ, Felton GW, Hoover K. Растение-хозяин и источник популяции определяют разнообразие микробных кишечных сообществ двух многоядных насекомых. Научный представитель2019; 9: 1–11.

    Google Scholar

  • 33.

    Hammer TJ, Janzen DH, Hallwachs W, Jaffe SP, Fierer N. Гусеницы не имеют постоянного микробиома кишечника. PNAS. 2017; 114: 9641–6.

    CAS PubMed Google Scholar

  • 34.

    Whitaker MRL, Salzman S, Sanders JG, Kaltenpoth M, Pierce NE. Микробные сообщества бабочек ликаенид не коррелируют с рационом личинок. Front Microbiol.2016; 7: 1–13.

    Google Scholar

  • 35.

    Стэнли Д., Гейер М.С., Хьюз Р.Дж., Денман С.Е., Мур Р.Дж.. Развитие микробиоты в желудочно-кишечном тракте цыплят сильно варьирует. PLoS One. 2013; 8: 6–13.

    Google Scholar

  • 36.

    Аскарате-Гарсия М., Руис-Родригес М., Диас-Лора С., Руис-Кастеллано С., Солер Дж. Дж. Разорванные экспериментально фекальные мешки влияют на бактериальную среду гнезда, развитие и выживание безупречных птенцов скворцов.J Avian Biol. 2019; 50: 1–10.

    Google Scholar

  • 37.

    Девейн А., Антунес А., Бедфорд А., Эштон П. Увеличение бактериальной нагрузки в течение сезона размножения в гнездах, занятых синей синицей, и ее потенциальное влияние на успех вылупления или окрыления. J Ornithol. 2018; 159: 1009–17.

    Google Scholar

  • 38.

    Janczyk P, Hall B, Souffrant WB. Состав микробного сообщества зоба и содержимого слепых кишок кур-несушек, получавших рацион с добавлением Chlorella vulgaris .Poult Sci. 2009; 88: 2324–32.

    CAS PubMed Google Scholar

  • 39.

    Уэйт Д.В., Тейлор М.В. Изучение микробиоты кишечника птиц: текущие тенденции и будущие направления. Front Microbiol. 2015; 6: 1–12.

    Google Scholar

  • 40.

    Пан Д., Ю. З. Микробиом кишечника домашней птицы и его взаимодействие с хозяином и диетой. Кишечные микробы. 2014; 5: 108–19.

    PubMed Google Scholar

  • 41.

    Льюис В.Б., Мур FR, Ван С. Изменения микробиоты кишечника мигрирующих воробьиных во время остановки после пересечения экологического барьера. Аук. 2017; 134: 137–45.

    Google Scholar

  • 42.

    Кулькарни С., Хиб П. Социальное и сексуальное поведение способствует передаче бактерий среди птиц. Поведенческий процесс. 2007; 74: 88–92.

    Google Scholar

  • 43.

    Докинз Р. Расширенный фенотип.Оксфорд: издательство Оксфордского университета; 1982.

    Google Scholar

  • 44.

    Фишер Д.Н., Хейнс Дж. А., Бутин С., Данцер Б., Лейн Дж. Э., Колтман Д. В. и др. Косвенное влияние на приспособленность между людьми, которые никогда не встречались через расширенный фенотип. Ecol Lett. 2019; 22: 697–706.

    PubMed Google Scholar

  • 45.

    Mennerat A, Perret P, Lambrechts MM. Местные индивидуальные предпочтения к материалам для гнездования воробьиных птиц.PLoS One. 2009; 4: 1–6.

    Google Scholar

  • 46.

    Blondel J, Thomas DW, Charmantier A, Perret P, Bourgault P, Lambrechts MM. Тридцатилетнее исследование фенотипических и генетических вариаций голубых синиц в мозаиках средиземноморской среды обитания. Биология. 2006; 56: 661–73.

    Google Scholar

  • 47.

    Блондель Дж., Диас П.К., Местр М., Перре П. Неоднородность местообитаний и изменение жизненного цикла средиземноморских синиц ( Parus caeruleus ).Аук. 1993; 110: 511–20.

    Google Scholar

  • 48.

    Visser ME, Van Noordwijk AJ, Tinbergen JM, Lessells CM. Более теплые пружины приводят к несвоевременному воспроизведению больших синиц ( Parus major ). Proc R Soc B Biol Sci. 1998; 265: 1867–70.

    Google Scholar

  • 49.

    Стеннинг М. Голубая синица, 1-е изд. (Т. и А. Д. Пойзер, Лондон, Великобритания, 2018 г.) стр. 69–109.

  • 50.

    Блондель Дж., Аронсон Дж., Бодиу Дж-Й, Бёф Г. Средиземноморский регион: биологическое разнообразие в пространстве и времени, 2-е изд. 2010. Издательство Оксфордского университета, Оксфорд.

  • 51.

    Шармантье А., Дутрелан С., Дубюк-Мессье Г., Фаржевьей А., Шулькин М. Средиземноморские синицы как пример местной адаптации. Evol Appl. 2016; 9: 135–52.

    PubMed Google Scholar

  • 52.

    Dubuc-Messier G, Réale D, Perret P, Charmantier A.Неоднородность окружающей среды и популяционные различия в личностных чертах голубых синиц. Behav Ecol. 2017; 28: 448–59.

    PubMed Google Scholar

  • 53.

    Банбура Дж., Блондель Дж., Де Вильде-Ламбрехтс Х., Галан М.-Дж., Местр М. Вариации рациона птенцов островной средиземноморской популяции голубых синиц Parus caeruleus : влияние лет, территорий и отдельных лиц. Oecologia. 1994; 100: 413–20.

    PubMed Google Scholar

  • 54.

    Alda F, Rey I, Doadrio I. Усовершенствованный метод извлечения образцов деградированной ДНК у птиц и других видов. Ардеола. 2007; 54: 331–4.

    Google Scholar

  • 55.

    Оэм Дж., Джуэн А., Нагиллер К., Нойхаузер С., Трауготт М. Молекулярная копрология: как повысить эффективность обнаружения ДНК жертвы в фекалиях птиц? Мол Экол Ресур. 2011; 11: 620–8.

    PubMed Google Scholar

  • 56.

    Эрикссон П., Муркас Э., Гонсалес-Акуна Д., Олсен Б., Эллстрём П. Оценка и оптимизация экстракции микробной ДНК из образцов фекалий диких видов антарктических птиц. Infect Ecol Epidemiol. 2017; 7: 1–9.

    Google Scholar

  • 57.

    Chelius MK, Triplett EW. Разнообразие архей и бактерий в связи с корнями Zea mays L. Micro Ecol. 2001; 41: 252–63.

    CAS Google Scholar

  • 58.

    Каллахан Б.Дж., Макмерди П.Дж., Розен М.Дж., Хан А.В., Джонсон А.Дж., Холмс С.П. DADA2: вывод образца с высоким разрешением из данных ампликона иллюминации. Нат методы. 2016; 13: 581–3.

    CAS PubMed PubMed Central Google Scholar

  • 59.

    Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T., Yarza P, et al. Проект базы данных генов рибосомных РНК SILVA: улучшенная обработка данных и веб-инструменты. Nucleic Acids Res. 2013; 41: D590–6.

    CAS PubMed PubMed Central Google Scholar

  • 60.

    Дэвис Н.М., Проктор Д., Холмс С.П., Релман Д.А., Каллахан Б.Дж. Простая статистическая идентификация и удаление загрязняющих последовательностей в данных маркера-гена и метагеномики. Микробиом. 2017; 6: 1–8.

    Google Scholar

  • 61.

    МакМурди П.Дж., Холмс С. phyloseq: пакет R для воспроизводимого интерактивного анализа и графики данных переписи микробиома.PLoS One. 2013; 8: 1–11.

    Google Scholar

  • 62.

    Андерсон MJ. Новый метод непараметрического многомерного дисперсионного анализа. Austral Ecol. 2001; 26: 32–46.

    Google Scholar

  • 63.

    Оксанен Дж., Бланше Ф.Г., Френдли М., Киндт Р., Лежандр П., МакГлинн Д. и др. веган: Экологический пакет сообщества. Пакет R версии 2.5-7. 2020.

  • 64.

    Vorholt JA.Микробная жизнь в филлосфере. Nat Rev Microbiol. 2012; 10: 828–40.

    CAS PubMed Google Scholar

  • 65.

    Bulgarelli D, Schlaeppi K, Spaepen S, van Themaat EVL, Schulze-Lefert P. Структура и функции бактериальной микробиоты растений. Annu Rev Plant Biol. 2013; 64: 807–38.

    CAS PubMed Google Scholar

  • 66.

    Мюллер Т., Руппель С. Прогресс в микробиологии филлосферы, не зависящей от культивирования.FEMS Microbiol Ecol. 2014; 87: 2–17.

    PubMed Google Scholar

  • 67.

    Чатурведи С., Рего А., Лукас Л.К., Гомперт З. Источники изменчивости кишечного микробного сообщества гусениц Lycaeides melissa . Научный доклад 2017; 7: 1–13.

    Google Scholar

  • 68.

    Videvall E, Strandh M, Engelbrecht A, Cloete S, Cornwallis CK. Измерение микробиома кишечника птиц: сравнение образцов фекалий и клоаки.Мол Экол Ресур. 2017; 18: 424–34.

    PubMed Google Scholar

  • 69.

    Льюис В.Б., Мур FR, Ван С. Характеристика кишечной микробиоты мигрирующих воробьиных во время остановки вдоль северного побережья Мексиканского залива. J Avian Biol. 2016; 47: 659–68.

    Google Scholar

  • 70.

    Sun CH, Liu H-Y, Zhang Y, Lu C-H. Сравнительный анализ микробиоты кишечника птицы-носорога и тукана в неволе.Microbiologyopen. 2019; 8: 1–7.

    CAS Google Scholar

  • 71.

    Teyssier A, Lens L, Matthysen E, White J. Динамика разнообразия кишечной микробиоты на раннем этапе развития птичьего хозяина: данные эксперимента с перекрестными опекунами. Front Microbiol. 2018; 9: 1–12.

    Google Scholar

  • 72.

    Амброзини Р., Корти М., Францетти А., Каприоли М., Руболини Д., Мотта В. М. и др.Микробиомы клоаки и экология отдельных амбарных ласточек. FEMS Microbiol Ecol. 2019; 95: 1–13.

    Google Scholar

  • 73.

    Минард Г., Тихонов Г., Оваскайнен О., Саастамойнен М. Микробиом бабочки Melitaea cinxia демонстрирует заметные вариации, но мало объясняется особенностями бабочки или растения-хозяина. Environ Microbiol. 2019; 21: 4253–69.

    CAS PubMed PubMed Central Google Scholar

  • 74.

    Godoy-Vitorino F, Leal SJ, Díaz WA, Rosales J, Goldfarb KC, García-Amado MA, et al. Различия в структуре бактериального сообщества сельскохозяйственных культур между гоацинами из разных географических регионов. Res Microbiol. 2012; 163: 211–20.

    PubMed Google Scholar

  • 75.

    Лукас Ф.С., Хиб П. Факторы окружающей среды формируют сообщества клоакальных бактерий у птенцов большой синицы Parus major и лазоревки P. caeruleus .J Avian Biol. 2005; 36: 510–6.

    Google Scholar

  • Спросите PFW: Сезон чаш и Очочинко

    Я слышал несколько слухов о том, что Патсы получили Очочинко (извините, если я неправильно написала) из Цинциннати … вы можете это проверить?
    Грант Лэмб

    Вы видите, что Патс делает шаг в пользу Чада Очочинко, видя, насколько у него и Беличика хорошие отношения? Если нет, то есть ли другие игроки, на которых вы могли бы увидеть, как Патсы пытаются обменять?
    Логан Байерс

    Что вы думаете о комментариях Чада Джонсона о возможном переезде в NE.Ты думаешь, что за этим что-то стоит, или он просто говорит нам чушь?
    Джейсон Родер

    Я слышал, что Чад Очочинко (он в настоящее время меняет его на Джонсона) сказал, что хочет быть патриотом Новой Англии. Билл Беличик тренировал его на Pro Bowl, и я думаю, что если бы он захотел это сделать, ему нужно было бы привести себя в порядок. Я также думаю, что он снова меняет свое имя, чтобы показать, что он перерастает свое прежнее «я», и потому, что он хочет обменять на Патриотов, а у нас уже есть 85.Мысли?
    Ник Регин

    Очочинко сейчас интересный парень. У него явно прочные, хотя и странные отношения с Беличиком. Он написал в Твиттере, что хотел бы сыграть в Новой Англии — «PePe and Bill #EPIC». (Для тех, кто не знает, Очочинко также называет себя PePe.) У него есть контракт на следующий сезон в Цинси с ценой в 6 миллионов долларов. Это много для 33-летнего ресивера, показатели которого падали последние три сезона. Это также много для парня, который может быть очень эмоциональным, легко отвлекающимся, незрелым и, казалось, был непростой задачей для Карсона Палмера.С учетом всего сказанного, и если предположить, что Очочинко (так я буду называть его, пока он законно не вернется к Джонсону) будет освобожден бенгалами, я был бы заинтересован в нем по правильной цене. В этом сезоне у него было 67 уловов на 831 ярд и четыре гола в 14 играх. Не совсем тот парень, который вскочил с кровати, сделав 1200 ярдов и 90 уловов, как в 2003-2007 годах, но это все равно приличное производство. Если Очочинко действительно смиренно приедет в Новую Англию со своей шляпой в руке, готовый вписаться и попытаться выиграть чемпионат, я был бы счастлив, если бы он участвовал в соревнованиях.Я все еще думаю, что это еще далеко, но его отношения с Беличиком действительно не могут повредить. «Патриотам» нужен парень, который мог бы уменьшить поле боя и увеличить глубину на приемнике, даже если есть опасения по поводу скорости №85. Очочинко / Джонсону нужен выигрышный дом. Это сработало пару лет с Рэнди Моссом. Новый примадонный ресивер брак? Я видел незнакомца.
    Энди Харт

    Я думаю, Патриоты должны были в начале года понять, что им нужно искать проверенного координатора нападения, кого-то, кто может держать в догадках другие команды, даже команды, которые находятся в нашем собственном дивизионе, они играют и слишком хорошо знают.Атаки, которые разыгрывались из-за боковой линии, просто не годятся в больших играх. Я знаю многих фанатов, которые это видят, интересно, почему об этом вообще не упомянули? Джо Дюссо

    Мы снова вернулись к критике пьесы? Чтобы было ясно, разве Патриоты не лидировали в НФЛ по очкам в этом сезоне? Обвиняем ли мы Билла О’Брайена в том, что он не справился со своей задачей в Суперкубке XLII? В тот момент он даже не был организатором или координатором игры.Я думаю, что О’Брайен хорошо поработал в этом году, возглавив нападение, особенно учитывая переход, который он прошел после обмена Мосса. Я думаю, что Патриоты, по большей части, назвали одни и те же пьесы во многих ситуациях, начиная с 2001 года. Были изменения кое-где, но много экранов и розыгрышей. Много коротких передач. Очень много работы с дробовиком, разнообразия построений и игровых действий. Это исполнение, которое я вижу, меняется от года к году, от игры к игре.Вот почему я обычно сосредотачиваюсь на похвале игроков, когда они добиваются успеха, потому что я также призываю их к ответственности с точки зрения исполнения, когда они не добиваются того же. Тренеры играют огромную роль в НФЛ, но давайте не будем переусердствовать. Я закончу своим общим вопросом для всех, кто просит о замене тренера — кого бы вы хотели нанять, чтобы объявить игру в нападении?
    Энди Харт

    Если фон Миллер выйдет за пределы топ-10, каковы шансы, что Патсы упакуют одного из своих первых раундеров и некоторых других, чтобы подняться, чтобы схватить его? Райан Джойс

    Это отличный вопрос, на который сейчас ни у кого нет ответа.Миллер считается элитным игроком на драфте. «Патриотам» очень нужен «срезчик кромки». Святой идеальный матч, заключенный на небесах, Бэтмен! Когда все сказано и сделано, Миллер, у которого была сильная неделя турнира Senior Bowl, сказал, что он хочет стать первым защищающимся игроком, выбранным на драфте. Если это произойдет, он будет выбран в топ-5. Наверное, это слишком богато для крови Патриотов. Но в вашем сценарии, и даже несмотря на то, что Миллер не является прототипом с точки зрения идеалов патриотов для OLB и установления преимущества, я должен думать, что Новая Англия рассмотрит возможность перемещения вверх на несколько позиций с No.17, чтобы удовлетворить свою самую большую потребность. Но мы все еще очень далеки от того, чтобы я был готов предсказать такой сценарий или даже посмотреть, будет ли Миллер доступен за пределами, скажем, пятого места в целом. Процесс драфта долгий, и ребята будут подниматься и падать в ближайшие недели и месяцы.
    Энди Харт

    Том Брэди не только играл со счетом 0: 3 в последних 3-х играх постсезона, но и не выходил из 1-го раунда в последних 2-х играх! Люди волнуются! Возможно, он потерял преимущество, Возможно, он немного отстает от великих игроков всех времен! Прежде чем мы полностью потеряем форму из-за этих опасений, давайте вернемся к великому Джо Монтане, сразу после того, как его команда выиграла лучший сезон в Суперкубке 1984 года! Люди забывают об этом — Джо Кул сам проиграл 3 раза подряд 1-го раунда в период с 1985 по 1987 год (по совпадению первые 3 года Джерри Райса в лиге) 2 из проигрышей были дома (21-10 ’85 Нью-Йорк Джайентс) 36-24 ’87, чтобы посредственные Миннесотские Викинги, и один был откровенным раундом 49: 3 к возможным Чемпионатам Суперкубка 86 Гигантов! Все мы знаем, чем занимался Джо в следующие 2 года — 88 и 89 лет! Том сделает это? Господь знает! Он может? Пойдем прямо сейчас! Я верю, что он МОЖЕТ и Уилл! И поднимется один-два вверх!
    Уилл Шорр

    Мне нравится ваша общая точка зрения, Уилл.Конечно, кажется, что небо падает с точки зрения недавней игры Патриотов в постсезонье. Но это не так. Единственная проблема заключается в том, что два из проигрышей 49ers были в качестве диких команд на выезде. Они были аутсайдерами и не ожидали победы. Три поражения «Патриотов» были с «Новой Англией» в качестве фаворита либо дома, либо на нейтральной площадке. Это другой взгляд на эту полосу неудач по сравнению с полосой Монтаны. Но суть в том, что даже великий Монтана пережил свою полосу поражений в постсезонке.Брейди тоже человек. Но будущее для № 12 может быть таким же светлым, как и для № 16 после сбоя в плей-офф с тремя играми. Проповедуй, брат! Я с вами.
    Энди Харт

    Мой вопрос касается широкого положения ресивера. Слухи о том, что Чад Джонсон и Столлворт говорят, что он хочет вернуться в Новую Англию, видите ли вы кого-нибудь из них в красно-бело-синем? Также насколько важно, чтобы мы добавили еще одну серьезную угрозу? «Джетс» отобрали середину поля, и это, казалось, сильно повредило нам в плей-офф, но нужны ли нам уже серьезные угрозы в команде? Может ли Брэндон Тейт стать жизнеспособным вариантом? В том немногом, что я видел о Тейлоре Прайсе, он казался талантливым и крутым.Сможет ли он выйти наружу в следующем году? Ники Ник

    Как я сказал выше, я был бы готов взять Чада на борт в нужной ситуации и посмотреть, что он может добавить к преступлению. Я бы сказал то же самое о Столлворте. Он был солиден в своем единственном сезоне в Новой Англии, но, очевидно, с тех пор много сделал на футбольном поле (19 ловушек за три года). Как ветеран по низкой цене, его опыт работы с системой сделает его хорошим потенциальным дополнением.Но оба парня были бы краткосрочным ответом на потребность Патриотов в внешнем ресивере, способном выходить на поле боя. Тейт и Прайс — это долгосрочные варианты. У меня нет больших надежд на то, что Тейт продвинется вперед. Мне еще предстоит многое от него увидеть, чтобы заставить меня поверить в то, что он может быть последовательным, надежным и функциональным вариантом в игре прохождения. Черт возьми, он даже не продемонстрировал способности быть надежной крупной угрозой. Цена полностью неизвестна. Мне понравилось то, что я видел от него на ранних сборах, и даже его действия в финале.Я думаю, что он более подвижный бегун, чем Тейт, у него могут быть лучшие руки, а также он довольно быстр сам по себе. Я все еще очень надеюсь на то, что Прайс станет универсальным вариантом для прохождения игры. Но он явно должен это доказать. Я бы не хотел, чтобы он был единственным парнем, который, как ожидается, выйдет в 2011 году, но если вы объедините его с ветераном, таким как Чад, Сталлворт или кем-то еще, это будет хорошим потенциальным стимулом для прохождения игры.
    Энди Харт

    Верны ли слухи о том, что Патриоты обменяют Уэса Велкера в это межсезонье? Если так, то куда он пойдет и что получит взамен Новая Англия? Блейк Стюарт

    Я слышал эти торгашеские слухи Велкера, но не более чем слухи низкого уровня в Интернете.Это ставит их на один уровень с инопланетянами, ставшими причиной недавних метелей. В то время как Велкер приближается к последнему году своего контракта и был отправлен на скамейку запасных перед началом недавней игры плей-офф, я не думаю, что есть много шансов, что он не будет Патриотом в 2011 году. Я также не знаю, есть ли там было бы очень интересно для него на открытом рынке. Ему всего год до серьезной травмы колена, ему нужен новый контракт, и некоторые считают его продуктом системы в Новой Англии.Справедливо это или нет, но на самом деле он не считается по-настоящему элитным ресивером или парнем, вокруг которого можно построить прохождение игры. Суть в том, что он вносит огромный вклад в Новую Англию и является любимой целью Тома Брэди. Я ожидаю, что он снова исполнит эту роль этой осенью.
    Энди Харт

    Я знаю, что вы, ребята, еще не вникали в черновик домашнего задания, но после просмотра основных моментов Джей Джей Уатта и Адриана Клейборна я не могу не прийти в восторг! Мне нравится способность Джей-Джея бросать бычий рывок, а также способность Адриана устанавливать и играть на грани.Я прекрасно отношусь к шансам «Патриотов». Что касается моего вопроса: как вы думаете, что Патриоты предложат Мэнкинсу? Будет ли это больше, меньше или будет таким же, чем то, что предлагали в предсезонке. Хэнк Б.

    Это еще один из тех замечательных вопросов. Очевидно, судя по его недавним комментариям, Мэнкинс не ожидает, что Patriots предложат прибыльное долгосрочное продление, которое он искал. Похоже, он думает, и я согласен, что наиболее вероятный сценарий на данном этапе — это то, что Патриоты наклеят ярлык франшизы на охранник All-Pro.В прошлом сезоне был объявлен тендер на сумму 10,731 миллиона долларов. Учитывая отсутствие CBA и неопределенность в сфере труда, это почти все, что мы можем ожидать на данный момент. Если новый CBA будет проводиться по тем же правилам, что и старый для ветеранов-свободных агентов, то я думаю, что Манкинс снова будет искать деньги Джахри Эванса. Охранник Saints All-Pro заключил семилетнюю сделку на сумму 56 миллионов долларов, в том числе 19 миллионов долларов за первый год и 25 миллионов долларов за первые три года.Это тот тип контрактов, с которым Патриотам придется иметь дело, если они попытаются подписать Мэнкинса. В противном случае им, возможно, придется использовать тег франшизы в качестве инструмента, прежде чем пытаться торговать якорем наступательной линии. Я все еще надеюсь, что сделка с Мэнкинсом будет заключена, даже если он не слишком уверен в себе. В прошлом году «Патриоты» позаботились о таких ключевых игроках, как Винс Уилфорк и Том Брэди. В этом году эти деньги должны достаться Мэнкинсу. Он — все, что вы ищете в атакующем лайнмене, как на поле, так и за его пределами.Было бы обидно отпустить его, особенно из-за неопределенности вокруг свободного агента Мэтта Лайта, а также часто травмированного охранника Стивена Нила. Но до тех пор, пока новый CBA не будет завершен, подобные вопросы о таких парнях, как Мэнкинс, будут просто развеваться на ветру неопределенности.
    Энди Харт

    Что вы думаете об этой мысли: Пэтс 3 раза подряд проигрывали в плей-офф, но в те же годы, хороший или отличный рег. рекорды сезона. Как вы думаете, если команда посмотрит, что пошло «не так» только в этих трех играх, и внесет эти «поправки», Патс сможет решить проблему плей-офф? Кажется, у них нет проблем с рег.сезонная игра.
    Джованна Сабатини

    Я уверен, что это вопрос, над которым размышлял Билл Беличик, когда он проходил процесс завершения сезона. Ясно, что «Патриоты» были очень хорошей командой в регулярном чемпионате. Но второй январь кряду в постсезоне не набрали. Две потери — это совпадение или заявление о том, как построена команда? Только Беличик действительно может позвонить и поработать над его устранением.Одна из теорий состоит в том, что нынешние «Патриоты» каким-то образом созданы для того, чтобы соревноваться с такими командами, как «Кольты», а не с физическими стилями вроде «Джетс» и «вороны». Не уверен, что куплюсь на это, но это теория. Очевидно, вы не говорите о взрыве чего-либо. На мой взгляд, «Патриотам» нужна помощь в защите от мяча. Еще несколько плеймейкеров сыграли бы важную роль. Большинство постсезонных игр, даже в случае самых серьезных нарушений, сводятся к необходимости того, чтобы защита команды внесла значительный вклад.Так что, хотя нападение «Патриотов» явно не дожило до своего резюме в регулярном сезоне в последних трех поражениях в постсезонье, я думаю, что защита остается главной целью для апгрейда. В оскорбительном плане речь идет о дополнительных вещах вокруг Брейди. С точки зрения защиты, речь идет о возвращении к тем временам, когда подразделение играло ключевую роль в ключевой момент в крупных играх постсезона.
    Энди Харт

    Как вы думаете, каковы шансы того, что BB и остальная часть фронт-офиса изменят свои планы приема на работу, аналогичные тем, которые они сделали после игры чемпионата AFC 2006 года, переходящей в сезон 16-0? Я вижу сходство в том, как закончился сезон тогда и сейчас; У нас был отличный шанс пробиться в Суперкубок, и мы проиграли команде, которую в наш день могли обыграть.На мой взгляд, это будет означать агрессивный ход в FA (Асамуга или Очо) или, возможно, обмен вверх и получение Куинна или фон Миллера). Насколько это будет зависеть от драм CBA?
    Энтони Пирсон

    Все, конечно, в свободном агентстве, будет зависеть от CBA. Но даже рост цен может зависеть от CBA с точки зрения шкалы заработной платы новичков, делающей высокие ставки более ценными. Хотя «Патриоты» большую часть прошлого сезона переподписывали своих игроков, кроме Мэнкинса, похоже, может быть больше внимания и ресурсов будет потрачено на свободных агентов из других команд.Если / когда CBA будет завершен, на открытом рынке могут появиться около 500 игроков. Это может стать хорошим моментом для Беличика и компании, чтобы нанести удар, чтобы пополнить состав. Я также не был бы шокирован, если бы увидел, что Беличик поменяется, чтобы получить конкретного игрока на драфте. У команды есть для этого ресурсы, и, взяв по дюжине игроков в каждый из двух последних драфтов, вероятно, сейчас больше потребность в большем количестве талантливых игроков, чем в юношеской глубине. Каким будет именно подход Беличика, остается только догадываться, но признаки могут указывать на более агрессивный подход как к свободному агентству, так и к драфту.
    Энди Харт

    С учетом всех имеющихся у нас драфтов, какие пики вы могли бы представить, чтобы «Патриоты» обменивались на проверенного приемника, такого как Ларри Фицджеральд? Могут ли они использовать высокие ставки на проверенного плеймейкера защиты и какой ценой?
    Лиам Холл

    Видите ли вы, как патриоты преследуют Винсента Джексона в свободном агентстве или обменивают пики на Ларри Фицджеральда?
    Коди Филлингери

    Я не думаю, что Патриоты заинтересуются Джексоном как свободным агентом.Думаю, цена будет слишком высока для парня, у которого были проблемы вне поля. Фицджеральд — другая история. (Конечно, никто не знает, присутствует ли он на рынке, несмотря на довольно расплывчатые сообщения в Интернете о том, что его можно было получить, но только по «правильной цене». Черт возьми, все доступны по правильной цене. Верно? И Фитцджеральд сказал, что хочет остаться в Аризоне.) Если он действительно станет доступным, я думаю, Патриотам придется, по крайней мере, проявить должную осмотрительность. У него уже есть контракт (до 2012 года), так что большого бонуса не стоит рассматривать.У него не было проблем за пределами поля. Он элитный талант. Даже с подозрительной игрой QB в Аризоне, 27-летний приемник сделал 90 уловов на более чем 1100 ярдов при шести приземлениях. За последние четыре года он поймал не менее 90 мячей. Он совершил 10 приземлений за четыре из последних шести лет. Он примерно такой же стабильный элитный ресивер, как и в игре, и он все еще находится на пике карьеры. Я бы принял его мгновенно и, если предположить, что запрашиваемая цена в сделке не будет слишком смешной, я думаю, что Беличик тоже ее рассмотрит.Почему бы и нет?
    Энди Харт

    Мне было интересно, видите ли вы, что Пэтс вернет Мосса, я сомневаюсь, что он попросит больше доллара из-за своего выступления в прошлом сезоне, и вы видите, что Пэтс меняет на элитного паса с одним из своих пиков в 1-м раунде, или Вы видите, что они могут получить Тамбу Хали из KC, у которого был сезон монстров в 2010 году. Майк Джексон

    Я не думаю, что Патриоты вернут Мосса. Я вроде как передумал по этому поводу.Раньше я как бы думал, что, учитывая все положительные слова, сказанные обеими сторонами после торговли Моссом, у него может быть шанс вернуться. Я думаю, что Патриоты только что ушли. Конечно, им по-прежнему нужна помощь в приемнике и в парне, который может растянуть поле. Но есть некоторый вопрос, способен ли Мосс на это больше. Я думаю, что эра Мосса в Новой Англии закончилась, но я никогда не говорю «никогда». Что касается Хали, я думаю, он идеально подошел бы Патриотам. У него был отличный год с 14.5 мешков для начальников в схеме, подобной Патриотам Ромео Креннеля. Он молод, ему всего 27 лет, у него пять лет опыта в НФЛ, забив не менее 7,5 мешков за четыре из пяти сезонов. Но я не думаю, что у Канзас-Сити есть много шансов его отпустить. Они либо подпишут его на расширение, либо используют свой тег франшизы. Могли ли Беличик и Скотт Пиоли заключить сделку, как они сделали с Мэттом Касселем? Может быть, но почему Пиоли захотел расстаться с одним из лучших молодых игроков в его развивающейся защите? Любителю Патриотов приятно мечтать, но вряд ли это произойдет.Еще один игрок на 3-4 паса, который может соответствовать их потребностям, — это ЛаМарр Вудли из Питтсбурга. Учитывая его роль в тени таких парней, как Джеймс Харрисон и Трой Поламалу в Питтсбурге, возможно, у него больше шансов преследовать его. Может быть. Он играет по несколько иной схеме и, возможно, извлек большую пользу из окружающих его талантов, но он все еще набирает двузначные сэки за три сезона подряд. Именно такая продукция нужна Патриотам.
    Энди Харт

    Следует ли Пэтс поменяться (это было бы изменением) и пойти на лучший пас-рашер? Нам нужно добраться до QB.Наблюдать за всеми топ-командами — это очень важно. Это заставляет вещи случаться! И, кстати, кто, по вашему мнению, является лучшим убийцей QB, которого мы могли бы заполучить, — призывником или свободным агентом. Спасибо.
    Дэвид Форд

    Я действительно думаю, что «Патриотам» нужно приложить дополнительные усилия, чтобы пройти в это межсезонье. Если это бесплатное агентство, заплатите дополнительный доллар. Если это черновик, то торгуйте, чтобы получить парня, которого вы считаете лучшим. Миллер, очевидно, получил много шума как один из элитных игроков на драфте.Меня все еще интересует Роберт Куинн. Хали или Вудли были бы хорошими кандидатами на свободу выбора. Я должен сказать, что меня больше всего заинтриговал Куинн, но знание Хали подобной системы также имеет большой смысл. Любой из четырех, вероятно, сделает пас лучше. Хуже быть не может.
    Энди Харт

    Как вы думаете, возможно ли, что патриоты выберут Адриана Клейборна в 17 лет, а затем Кейси Мэтьюза в 28? Кори Лима

    Конечно, это возможно. В драфте все возможно.Но давайте не будем пытаться восполнить упущенный Клэя Мэтьюз, переоценивая его брата. По большому счету, последний Мэттьюз — внутренний полузащитник середины раунда. У Патриотов в этом вопросе неплохой талант и глубина. И, несмотря на то, что он разделяет фамилию со своим братом, который бросает пас, этот Мэтьюз уже не тот игрок. Составление этого не компенсирует того, что вы не написали последний.
    Энди Харт

    Просто интересно про тренера OL. Я знаю, что он всегда был в NE.Почему он никогда не упоминался как возможный главный тренер. Кажется, он может превращать лимоны в лимонад, но редко привлекает к себе внимание. Твои мысли. Майк Брин

    На мой взгляд, Данте Скарнеккья — один из лучших помощников тренера в игре. Я думаю, что он каждый год максимизирует свой талант в атаке. Он делает приличных игроков хорошими, хороших игроков — великими, а сомнительных игроков — конкурентоспособными. О чем еще ты можешь попросить? Он также один из самых приятных людей, которых я встречал в этом бизнесе.Он почти не получает того признания, которого заслуживает. Он был с Патриотами 27 из своих 29 сезонов в НФЛ. Он помощник главного тренера команды и пережил множество тренерских изменений, даже смену владельцев. Это говорит о том, какой он человек и тренер. Мне почти 63 года, и я не думаю, что он стоит в очереди на должность главного тренера. Не уверен, что он когда-либо действительно стремился стать главным тренером. Не уверен, что ему нравятся все средства массовой информации и другие задачи, связанные с работой главного тренера. Я думаю, он любит футбол и любит работать со своими игроками.Став главным тренером, вы часто упускаете из виду кое-что из этого. Тем не менее, Скарнеккия является ценным членом организации Patriots и на протяжении многих лет внес большой вклад в успех команды.
    Энди Харт

    Как вы думаете, почему Том Брэди не мог играть по-крупному или широкие приемные не могли передать мяч? Как вы думаете, струи обманывали?
    Энтони Снерр

    Привет, ребята, если бы вы могли подписать одного свободного агента, который не играл в этом сезоне, кого бы вы выбрали и почему? (при условии, что подписанные игроки, такие как Логан Мэнкинс, уже подписали контракт с игроками, такими как Логан Мэнкинс) Я лично хотел бы, чтобы они схватили Asomugha, лучший ресивер, такой как Rice, или хороший предохранитель (если он есть на рынке). Питер Мулард

    Хали или Вудли. Я по-прежнему считаю, что Патриотам больше всего нужны пасы, и любой из них мог бы помочь в этой области.
    Энди Харт

    Каковы шансы комбинации Уилфорка и Хейнсворта впереди? Чейз Фостер

    Нулевая точка нуля. Хейнсворт не хотел играть в 3–4 в Вашингтоне, с чего бы это изменилось в Новой Англии? К тому же, я не думаю, что Беличик заинтересован в том, чтобы привлечь к себе парня, у которого такая заноза в заднице.Меня бы не интересовал Хейнсворт, и я не думаю, что Беличик тоже.
    Энди Харт

    Я единственный, кто чувствует, что обороне Патриотов не хватает того же уровня интеллекта, что и у Сеймура, Врабеля, Харрисона и Бруски? Они не были быстрыми, но всегда были в нужном месте. Помню, Беличик даже хвалил Врабеля за то, что он не пропускал ни одного задания за несколько сезонов. Не могу сказать этого о наших нынешних защитниках. Дэвид Самуэль

    Защита явно что-то потеряла с потерей ключевых игроков.Это мог быть интеллект. Это мог быть талант. Это могла быть способность делать большие игры. Это может быть комбинация всего этого. Ясно, что интеллект — это ключ к защитным схемам «Патриотов», и мы, очевидно, видели, как парни совершали умственные ошибки в игре с полузащитником и защитой в последний год или около того. Возможно, этого не произошло с теми ветеранами, которые были в составе. Теперь ключевым моментом является поиск парней, обладающих умственными способностями, а также способностями к игре. Девин МакКурти похож на одного из них. Джерод Мэйо похож на другого.Этот список должен расшириться в ближайшие годы, если защита «Патриотов» вернется к своей славной форме.
    Энди Харт

    Насколько высоко, по вашему мнению, могли бы разменяться Патсы, если бы они отказались от 17-го и 28-го пиков на драфте? Есть ли какой-нибудь внешний полузащитник, на которого стоит поторговаться? Доступны ли какие-либо бесплатные агенты, которые могут помочь в ускорении прохода? Спасибо, парни. Майк Андерсон

    Согласно широко распространенной и общепризнанной диаграмме значений драфта, 17-й пик приносит 950 очков, а 28-е место приносит 660 очков.Вместе они набирают 1610 очков, этого достаточно, чтобы занять шестое место в драфте. Еще 200 очков в пике (равном 78-му пику в драфте) позволят вам подняться до пика №4, в то время как для того, чтобы добраться до общего пика №1, требуется 3000 очков. Обменяв свои первые три пика — 17, 28 и 33 — Патриоты могли попасть под номер 3. Стоит ли такая сделка для Миллера? Куинн? Возможно, хотя я еще недостаточно изучил этих игроков, чтобы сделать это. Я тоже не думаю, что команды сделали такую ​​оценку.
    Энди Харт

    Учитывая все, что произошло за последние два или три года, будет ли в этом году BB сойти со своей высокой лошади и понять, что он не может делать все в одиночку, и взять с собой координатора нападения и координатора защиты? В прошлом году мы упустили возможность вернуть старую группу вместе с Вайсом и Креннелем, так что, возможно, в этом году он пересмотрит свое решение и получит ОК и ОК. Мы, и я имею в виду всех фанатов «Патриотов», устали от ЕДИНСТВЕННЫХ выступлений в постсезонье, особенно после великолепного сезона, который у нас был в этом году.Итак, скажет ли Боб Крафт по этому поводу? И не пора ли ББ задуматься о выходе на пенсию (хотя он станет одним из величайших тренеров всех времен) и наполнить тренерский штаб новой кровью? Билл Кауэр все еще доступен, как и Джон Груден, среди прочих. Как вы думаете, один из этих великих тренеров когда-нибудь приедет в Фоксборо? Что вы думаете? Серджио Оливейра

    Я предполагаю, и это всего лишь мои предположения, что Билл О’Брайен будет повышен до координатора нападения в какой-то момент в этом межсезонье.Это может быть даже не анонс, а просто титульное продвижение. Что касается защиты, я не уверен, что следующей осенью будет координатор. Эта работа может по-прежнему быть разделена между Беличиком и тренером полузащитников Мэттом Патрисией. Не думаю, что отсутствие координаторов стало причиной поражения команды в плей-офф. Я, конечно, не думаю, что пора начинать выталкивать Беличика за дверь. В то время как Крафт в целом говорит обо всем, что он хочет как владелец, он оставляет решение о футболе и выбор тренерского штаба на усмотрение Беличика.И я не заинтересован в замене Беличика Биллом Кауэром или Джоном Груденом. Я вообще-то думаю, что Кауэр — довольно переоцененный главный тренер. Его команды проигрывали в постсезоне так же часто, как и добивались успеха, даже пару раз проигрывая Патриотам дома. Также он не имеет опыта принятия кадровых решений. С тех пор, как я печатаю, Cowher — один из самых переоцененных товаров для коучинга в истории. Он хороший тренер, но не великий. И, на мой взгляд, это не тот парень, которому я бы передал ключи от своей франшизы с мыслью, что он может все перестроить и все изменить.Я останусь с Беличиком, большое вам спасибо.
    Энди Харт

    Привет, мне было интересно, на каких позициях и за какими игроками «Патриоты» попытаются пойти на драфте этого года? И что будет, если в следующем году не будет НФЛ? Означает ли это, что все наши выборы на драфте пропадают, или мы просто получим их, когда лига вернется.
    Кевин Макейл

    Драфт будет происходить неважно в апреле этого года. Единственное изменение заключается в том, что эти пики и любые незадействованные свободные агенты не могут подписывать контракты с командами до тех пор, пока не будет подписано новое коллективное соглашение.Если перерыв в работе продлится больше, чем полный год, и в следующем апрельском проекте, я думаю, все станет действительно некрасиво. Но это далеко. На данный момент «Патриоты» будут использовать все свои драфты в апреле, а затем просто должны будут дождаться их подписания, пока не будет согласован новый CBA, если он еще не принят к тому времени.
    Энди Харт

    Как физически Майк Райт, Тай Уоррен и Ли Бодден? Я действительно смущен и напуган Райтом, но надеюсь, что все полностью выздоровеют.
    Джексон Перри

    Стоит посмотреть, как все три ключевых защитника работают, чтобы вернуться на поле. Я думаю, что Бодден — это замок, который сможет вернуться и быть здоровым к следующему сезону после операции и реабилитации на плече. Я не слишком переживаю за него. Уоррен перенес операцию на бедре и все еще восстанавливается. Прогноз его полного выздоровления кажется довольно оптимистичным, но у меня все еще есть опасения по поводу таких больших парней, как Уоррен, и идеи, что он должен вернуться после операции на бедре. Но, учитывая, как долго он переживал травму, есть надежда, что он вернется и будет готов к 2011 году.Для меня Райт — самая большая проблема. Сообщается, что у него все еще были проблемы после сотрясения мозга, когда он был поставлен на IR почти через два месяца после травмы, в том числе проблемы с просмотром телевизора. Сотрясение мозга может быть очень болезненным, особенно если оно серьезное. Мы видели это за последний год с Марком Сэваром для Брюинз. Даже если Райт выздоровеет в это межсезонье, как он отреагирует на удары, которые получит на тренировке или в игре в футбол? Ни у кого нет ответа на этот вопрос. Это меня беспокоит.
    Энди Харт

    Я действительно сбит с толку, почему все говорят, что нам нужен угловой, когда в этом сезоне вернется Бодден, и я знаю, что Аррингтон не так хорош, но я думаю, что он был бы отличным никелевым корнером.И я много слышу о том, что нам нужна спина №1, что также не имеет для меня смысла. Я думал, что BJGE более чем способен нести эту ношу, и был бы рад увидеть, как он сделает это снова в следующем году. Он не ковыляет и почти всегда заканчивает с положительным результатом, даже если это всего пара здесь и там, это все равно намного лучше, чем спина, которая прыгает и заканчивается на спине, теряя ярды. Крис Тиберж

    Я с вами по делу Боддена. Думаю, Бодден и МакКурти составляют хорошую стартовую пару угловых.Аррингтон, Дариус Батлер и другие заполнят глубину позиции. Но я по-другому смотрю на ситуацию с бегством. Я думал, что Грин-Эллис был хорош в этом году, вероятно, лучше, чем я думал, что он когда-либо будет. Я не думал, что он когда-либо действительно нес груз, скорее, он вносил дополнительный вклад в прохождение игры. Он определенно не был Кори Диллон 2004 года. Он определенно был лучше, чем Лоуренс Марони, на которого вы, похоже, ссылались в своих заключительных комментариях. Я по-прежнему считаю, что команда может выиграть от бегущего бека, который не только может быть неизменно позитивным, но также может представлять угрозу для большой игры или утомлять защиту.Я не уверен, что Грин-Эллис был или когда-либо будет этим парнем. Я хотел бы, если возможно, снова увидеть гвоздь в миксе, хотя я не думаю, что это самая большая проблема для этой команды. Эта честь по-прежнему выпадает на долю защиты, и особенно при пасе.
    Энди Харт

    Как вы думаете, Том Брэди мог бы лучше управлять мячом, если бы не травма ступни. Или ему просто не нравится играть в футбол?
    Jose De La Curz

    Том Брэди не зарабатывает на жизнь и не выигрывает игры ногами.Он не торопится начинать, не так уж и далек от травмы ACL и имел дело с травмой стопы. Если я защищаюсь, я считаю победой каждый раз, когда Брэди управляет мячом, независимо от того, сколько ярдов он получил. Я также не думаю, что он смог бы пройти много ярдов на земле против Джетс, независимо от его здоровья. Брэди зарабатывает на жизнь, стоя в кармане и разбирая защиту. Вот и все. Если вы хотите, чтобы защитник бежал, вам следует поискать в другом месте.
    Энди Харт

    границ | Социальная среда оказывает основное влияние на микробиологический профиль и запахи у химически сигнальной певчей птицы

    Введение

    Животные повсеместно взаимодействуют с симбиотическими (т.е., резидентные) микробы, многие из которых приносят существенную пользу своим хозяевам (Gilbert et al., 2012; McFall-Ngai et al., 2013). Например, симбиотические микробы предоставляют своим хозяевам доступ к иначе недоступной энергии и питательным веществам (Tremaroli and Backhed, 2012; Hacquard et al., 2015), они стимулируют и укрепляют иммунную систему хозяина (Hooper et al., 2012; Lee and Hase, 2014), они катализируют эффективное развитие и функционирование органов хозяина (McFall-Ngai, 2002; Fraune, Bosch, 2010) и могут напрямую влиять на поведенческие фенотипы своих хозяев (Archie and Theis, 2011; Ezenwa et al., 2012), включая химические сигналы, используемые во внутривидовой коммуникации (Archie, Theis, 2011; Ezenwa, Williams, 2014). Ключевым направлением исследований современной микробной экологии хозяина является определение относительного влияния окружающей среды и генотипа хозяина на развитие микробиоты отдельного хозяина (Spor et al., 2011; Goodrich et al., 2014; Org et al., 2015). Различение этих эффектов особенно интригует при рассмотрении потенциального вклада симбиотических микробов во внутривидовую химическую передачу сигналов, поскольку химические сигналы животных часто считаются показателями индивидуального генетического качества (Johansson and Jones, 2007), особенно когда они связаны с иммунной функцией. или паразитарная нагрузка (Penn and Potts, 1998).То, что симбиотические микробные сообщества и, следовательно, химические сигналы животных, на самом деле могут сильно зависеть от окружающей среды животных, поднимает интересные вопросы, касающиеся верности сигналов, честности и отбора.

    Хотя логически очевидно, что вариации как окружающей среды, так и генотипов хозяев могут формировать микробиоту хозяина, степень, в которой эти факторы фактически влияют на это, и масштабы, в которых они действуют, остаются в значительной степени неизвестными. Среди людей, несмотря на высокие межиндивидуальные различия в составе и структуре кишечной микробиоты, сигнатуры микробного сообщества все еще обычно очевидны на уровне семейных домохозяйств и даже наций (Turnbaugh et al., 2009; Ли и др., 2011; Яцуненко и др., 2012; Goodrich et al., 2014). Эти закономерности могут быть связаны либо с вариациями в общих средах, либо с генетическим родством (Spor et al., 2011; Goodrich et al., 2014; Org et al., 2015). Большинство доступных данных свидетельствуют о сильном экологическом компоненте в формировании микробиоты кишечника человека: сожительствующие родители имеют более сходную микробиоту кишечника, чем мужчины и женщины, не живущие вместе (Яцуненко и др., 2012), а у монозиготных и дизиготных пар близнецов обычно микробиота кишечника, которая различаются в одинаковой степени (Turnbaugh et al., 2009; Ли и др., 2011; Яцуненко и др., 2012). Однако недавнее исследование продемонстрировало роль генетического родства, поставив под сомнение эти предыдущие исследования близнецов: они обнаружили, что монозиготные близнецы действительно имеют более сходную микробиоту кишечника, чем дизиготные близнецы, и дополнительно продемонстрировали высокую наследуемость некоторых типов кишечных бактерий, в частности, члены семейства Christensenellaceae (недавно описанный таксон, связанный со здоровьем и худощавостью у людей), по-видимому, составляют центр модуля сопутствующих наследственных семейств микробов (Goodrich et al., 2014).

    Существуют однозначные доказательства факторов, влияющих на микробиоту большинства других животных. В широком смысле специфичность микробиоты хозяина в различных средах предполагает, что генетика хозяина перевешивает влияние окружающей среды в отношении того, какие микробы могут колонизировать виды животных. Например, микробиота эпителия значительно различается между двумя родственниками книдарий Hydra , а микробиота особей в линиях гидры, поддерживаемых в лаборатории более трех десятилетий, оставалась аналогичной микробиоте их диких сородичей (Fraune and Bosch, 2007).Несколько исследований даже идентифицировали специфические гены-хозяева, которые влияют на состав микробиоты человека; в первую очередь это гены, участвующие в иммунной функции, но некоторые из них играют метаболическую роль (обзор в Spor et al., 2011). Однако влияние окружающей среды, по-видимому, по-прежнему является причиной значительных различий в составе и структуре микробиоты животных. Примечательно, что окружающая среда человека включает в себя сородичей, особенно социальных видов. В животном мире вертикальная и / или горизонтальная передача микробов от матери к потомству представляется универсальной (Funkhouser and Bordenstein, 2013).У млекопитающих естественные роды и лактация являются основными механизмами заражения новорожденных микробами, тогда как у птиц откладка яиц, инкубация и высиживание могут эффективно передавать микробы цыплятам (Ruiz-de-Castañeda et al., 2011a). Не родственники также могут вносить ключевой вклад в микробиоту человека. Например, у желтых павианов ( Papio cynocephalus ) членство в социальных группах и сети ухода являются самыми сильными предикторами структуры кишечной микробиоты (Tung et al., 2015), а взрослые зебры ( Taeniopygia guttata ) разделяют клоакальные микробы через копуляция и аллопрининг (Kulkarni and Heeb, 2007).К другим факторам окружающей среды, которые могут заметно повлиять на микробиоту, относятся вариации в питании (Wu et al., 2011; David et al., 2014) и стохастическая изменчивость в процессе колонизации разных людей (Sloan et al., 2006; Spor et al., 2011).

    Наиболее широко изученные взаимосвязи между симбиотическими микробами и поведением животных до сих пор относятся к области внутривидовой химической коммуникации (Archie and Theis, 2011; Davis et al., 2013; Ezenwa and Williams, 2014). Гипотеза ферментации для химической коммуникации животных (Albone, 1984) предполагает, что некоторые компоненты химических сигналов животных являются продуктами симбиотического микробного метаболизма, и что вариации этих сигналов, как между видами, так и внутри видов, частично обусловлены лежащими в основе вариациями в структура пахучих микробных сообществ животных.Было высказано предположение, что микробы-симбиотики вносят запахи, передающие большой объем информации о животных-хозяевах, включая их виды и индивидуальную принадлежность, членство в группах, пол, репродуктивное состояние и общее качество (Archie and Theis, 2011; Davis et al., 2013 ; Ezenwa, Williams, 2014).

    Здесь мы оцениваем влияние вариаций окружающей среды и генотипа хозяина на формирование микробиоты и химических сигналов певчей птицы, подвида темноглазых юнко из Каролины ( Junco hyemalis carolinensis ).Предыдущие исследования показали, что существует сильное влияние окружающей среды на микробиоту птиц как в клоаке, так и в уропигиальной железе (Lucas and Heeb, 2005; Klomp et al., 2008; Ruiz-Rodriguez et al., 2014). Перекрестная инфекция является вероятным объяснением этих закономерностей, поскольку симбиотические бактерии могут передаваться партнерам через совокупление и другим социальным партнерам через совместное проживание и аллопрининг (Westneat and Rambo, 2000; Kulkarni and Heeb, 2007; White et al., 2010), и симбиотические бактерии также могут легко передаваться от матери к потомству во время кладки яиц, высиживания потомства и ухода (Ruiz-de-Castañeda et al., 2011а, б). Уропигиальная железа выделяет жир, который птицы наносят на свои перья своими клювами для очистки и ухода за перьями, а также для управления разлагающими перья бактериальными сообществами, которые их населяют (Jacob and Ziswiler, 1982; Shawkey et al., 2003; Martín-Vivaldi и др., 2009, 2010). Это масло также содержит летучие соединения, которые могут передавать информацию о видовой принадлежности человека (Soini et al., 2013), поле (Soini et al., 2007; Whittaker et al., 2010), возрасте (Shaw et al., 2011) и условия размножения (Whittaker et al., 2011), и это может даже быть предиктором репродуктивного успеха человека (Whittaker et al., 2013). Недавно мы продемонстрировали, что в уропигиальной железе темноглазого юнко обитает разнообразное и богатое бактериальное сообщество, и что известно, что некоторые из идентифицированных родов бактерий продуцируют летучие соединения, присутствующие в масле юнко-приманки (Whittaker and Theis, 2016). Насколько нам известно, ни одно исследование еще не продемонстрировало, что симбиотические бактерии производят химические сигналы птиц.

    В этом исследовании мы определяем относительное влияние социальной среды и генетического родства между братьями и сестрами и их родителями на формирование состава и структуры птичьих бактериальных и запаховых профилей в дикой популяции темноглазых юнко. Темноглазый юнко — широко распространенный североамериканский воробей-эмберизид, который более века был предметом полевых, физиологических и эволюционных исследований, а также исследований в неволе (Nolan et al., 2002). Что касается поведенческой экологии, то джунко является важной исследовательской системой для изучения широкого круга тем, включая биологическое время миграции и размножения (Rowan, 1925; Ball and Ketterson, 2007), роль гормонов и реагирующих тканей в модуляция и эволюция поведения (Ketterson and Nolan, 1992; Ketterson et al., 2001; Bergeon Burns et al., 2013) и адаптации к новым условиям (Atwell et al., 2014). Фактически, темноглазый юнко был назван экологическим модельным организмом (Peterson et al., 2012).

    Одной из черт, которая делает темноглазых юнко такими интригующими объектами исследования, является то, что, хотя они социально моногамны (Nolan et al., 2002), они демонстрируют заметный уровень внепарного отцовства (EPP) — около 30% потомков в все популяции, изученные на сегодняшний день, произошли от самца дополнительной пары (Ketterson et al., 1998; Герлах и др., 2012а, б; Atwell et al., 2014). Это различие в отцовстве создает своего рода естественный эксперимент, позволяющий сравнивать диады родитель-потомство и группы братьев и сестер с разным уровнем генетического родства. Самки насиживают яйца в течение 12 дней, а птенцов — 11–12 дней, в это время птенцы обычно оперяются (Nolan et al., 2002). И самцы, и самки дают птенцов, но поскольку только самки вынашивают яйца и птенцов, мы также можем сравнить влияние физического контакта между потомством и двумя родителями на сходство бактерий и запаха.

    Наши конкретные цели в этом исследовании состояли в том, чтобы (1) оценить влияние пола, возраста (т. Е. Взрослые особи по сравнению с птенцами) и идентичности гнезда на клоакальную и уропигиальную микробиоту юнко; (2) оценить влияние тех же переменных на профили летучих запахов масла junco preen; (3) тест на ковариацию между микробными и летучими профилями junco; и (4) выяснить относительное влияние этой социальной среды (например, степень физического контакта) и генетическое родство (то есть родственные и неродственные пары родитель-потомок; полные против неродственных).полукровные братья и сестры) имеют в формировании развивающейся микробиоты юнко и профили летучих запахов.

    Методы

    Сбор проб

    Мы провели это исследование каролинского подвида темноглазого юнко на биологической станции Маунтин-Лейк (MLBS) недалеко от Пембрука, Вирджиния, США (37 ° 22′N, 80 ° 32′W). MLBS — это сайт долгосрочного исследования темноглазых юнко, проводимого Эллен Кеттерсон из Университета Индианы с 1983 года. В рамках долгосрочного исследования взрослых юнко отлавливают каждый год с помощью ловушек и ловушек с наживкой с середины апреля. до середины мая, чтобы провести перепись возвращающихся особей и связать новых птиц с бандами Службы охраны рыбных ресурсов и дикой природы США.Исследователи также проводят морфологические измерения всех птиц и определяют пол по наличию пятна расплода (самка) или клоакального выроста (самец), а также по оперению и длине крыла (Nolan et al., 2002). Для определения отцовства небольшой образец крови (50–100 мкл) берут из крыловой вены каждой птицы и хранят в буферном растворе для лизиса Лонгмайра (Longmire et al., 1992) при 4 ° C. Всех птиц выпускают на место отлова, обычно менее чем через 1 час после отлова.

    проб для этого конкретного исследования было собрано в мае-июне 2012 г. Мы интенсивно искали гнезда ежедневно в течение мая, и как только мы нашли гнездо, мы наблюдали за ним через день до вылупления (день 0). На 3-й и 6-й день мы взвешивали птенцов, а на 6-й день мы обвязывали каждого птенца и брали небольшой образец крови для определения отцовства и определения пола. На 11–12 день (время, когда птенцы юнко обычно покидают гнездо, или «оперяются»), мы отлавливали птенцов, а также взрослых особей во всех гнездах, чтобы проверить личность социального отца и собрать образцы крови, если они ранее не были получены.Затем мы взяли пробы сообществ клоак и уропигиальных бактерий каждого человека и взяли пробы чистящего масла. Мы взяли образцы бактериальных сообществ клоаки, осторожно взяв мазок из отверстия клоаки. Мы взяли образцы бактериальных сообществ мочеполовой железы, протерев кончик железы стерильным ватным тампоном, который стимулирует выработку масла для чистки, и убедился, что полученный нами раствор был подобен смеси, которую юнко собирают на своих счетах для чистки. Все мазки хранили в криогенных флаконах при -80 ° C до анализа.Масло Прина собирали, осторожно протирая уропигиальную железу стеклянной капиллярной трубкой объемом 100 мкл (Drummond Scientific, Broomall, PA). Это действие стимулирует железу выделять 1–3 мг очищенного масла (Whittaker et al., 2010). Мы хранили пробы очищенного масла на льду сразу после сбора, при -20 ° C в течение 1 часа и длительное время при -80 ° C, пока они не были проанализированы с помощью газовой хроматографии-масс-спектрометрии (ГХ-МС).

    После отбора имаго были выпущены на место отлова, а птенцов возвращены в гнездо.Всего мы отобрали 9 взрослых самок, 8 взрослых самцов (одно гнездо не посещал взрослый самец) и 27 птенцов из 9 гнезд (диапазон: 2–4 птенца / гнездо) в MLBS (рис. 1). Это исследование основано на предварительном исследовании, в котором мы охарактеризовали микробиоту мочевых желез взрослых юнко из 13 гнезд (Whittaker and Theis, 2016). Сюда мы дополнительно включаем данные о птенцах юнко и данные о клоакальной микробиоте, профилях летучих мочевых желез и отцовстве. Настоящее исследование сосредоточено на 9 гнездах, потому что у нас не было профилей микробиоты, профилей летучих соединений и / или данных об отцовстве для всех птенцов из 4 гнезд, отобранных в 2012 году.Это исследование было проведено в соответствии с руководящими принципами Блумингтонского институционального комитета по уходу и использованию животных (протокол BIACUC 12-050), разрешением Службы рыболовства и дикой природы США MB0-0 и разрешением 041506.

    Департамента охоты и рыболовства Вирджинии.

    Рис. 1. Относительное расположение девяти гнезд темноглазых джунко, одновременно отобранных на биологической станции Маунтин-Лейк (MLBS), Вирджиния, . Цветовая кодировка для конкретного гнезда сохраняется на рисунках на протяжении всей статьи, если это применимо.

    Анализ отцовства и пола

    Мы экстрагировали ДНК юнко из образцов крови, используя стандартные фенол-хлороформные методы (Sambrook et al., 1989) и наборы геномной ДНК IBI Scientific MINI (Peosta, IA). Мы генотипировали взрослых птиц и птенцов по восьми микросателлитным локусам (Gerlach et al., 2012a) и определили отцовство с помощью программы CERVUS 3.0 (Kalinowski et al., 2007). Мы определили пол каждого птенца путем амплификации гена CHD на W- и Z-хромосомах; самцы и самки гомогаметны и гетерогаметны соответственно (Griffiths et al., 1998).

    Из 9 отобранных гнезд, 3 содержали только детенышей внутри пары (WPY), 2 содержали только детенышей экстра-пары (EPY), а 4 имели смешанное отцовство, включая детенышей WPY и EPY. Одиннадцать из 27 птенцов (41%) были EPY. Одно из гнезд только для EPY содержало молодняк от нескольких разных самцов. Одно смешанное отцовское гнездо содержало детенышей от 3 разных самцов. Таким образом, 4 гнезда содержали только полных братьев и сестер, а 5 — полных братьев и сестер от нескольких самцов. В дальнейшем мы будем использовать «родители» и «отец» для обозначения сопровождающего самца в гнезде (который может быть или не быть генетическим отцом).

    Секвенирование и характеристика микробиоты

    Мы экстрагировали ДНК из бактерий на тампонах с использованием наборов для выделения ДНК MO BIO PowerSoil ® (MO BIO Laboratories, Inc., Карлсбад, Калифорния), следуя рекомендованному производителем протоколу, с двумя дополнительными шагами: мы инкубировали тампон в растворе шариков. внутри пробирки с шариками в течение 10 мин, а затем энергично встряхивали пробирку с шариками в течение 1 мин перед тем, как асептически удалить тампон и продолжить экстракцию. Порядок извлечения был рандомизирован в зависимости от индивидуальности и принадлежности гнезда, пола, органа и возрастной группы.Экстракции образцов дали амплифицируемую рДНК 16S, очевидную с помощью гель-электрофореза, тогда как пустые контрольные экстракции не дали. Однако это не препятствует амплификации и окончательному секвенированию следов фоновой ДНК в наборах для экстракции и / или реагентах (Salter et al., 2014). Следовательно, широта таксономического разнообразия бактерий, наблюдаемая в этом исследовании, должна рассматриваться как предварительное наблюдение, требующее дальнейшей проверки посредством метагеномного секвенирования и целевого культивирования. Область V4 бактериального гена 16S рРНК была нацелена на секвенирование на платформе Illumina MiSeq в Центре поддержки технологий исследований Университета штата Мичиган Genomics Core.Подготовка образцов, секвенирование нуклеотидов и предварительная качественная фильтрация были выполнены с использованием ранее опубликованных и широко применяемых протоколов Illumina (Caporaso et al., 2012).

    Файлы запуска MiSeq для конкретных образцов, которые были депонированы в архиве чтения последовательностей NCBI (BioProject ID PRJNA328228; Accession SRP078320), были обработаны с использованием программного обеспечения mothur, v. 1.31.2 (Schloss et al., 2009; Kozich et al. , 2013). Мы удалили все последовательности, которые (1) содержали неоднозначные вызовы оснований, (2) имели ряды гомополимеров, превышающие 8 оснований, (3) не начинались и не заканчивались в соответствующих положениях праймера, (4) были помечены как химерные с помощью инструмента uchime или ( 5) были таксономически классифицированы как митохондрии, хлоропласты, археи, эукариоты или неизвестные с использованием справочной базы данных trainset9_032012 проекта Ribosomal Database Project (Wang et al., 2007; Claesson et al., 2009). Этот процесс удалил 25% всех последовательностей. Один образец клоаки от птенца-самца не был успешно секвенирован из-за низкого восстановления ДНК, поэтому данные из этого образца были отброшены. Каждая из 87 оставшихся выборок была подвергнута субдискретизации на глубину 6000 последовательностей, что соответствует количеству последовательностей в наименее представленной выборке. Эти последовательности были объединены в операционные таксономические единицы (OTU) с использованием среднего соседа mothur, алгоритма разбиения-кластеризации (уровень 3) и ограничения сходства последовательностей 97%.Охват выборкой был высоким, о чем свидетельствует оценка Гуда, составляющая в среднем 97,8 ± 0,5 и 97,6 ± 2,5% для клоаки и уропигиальных желез соответственно. Все анализы альфа-разнообразия были выполнены с использованием полного набора данных OTU. В частности, для каждого образца мы использовали количество наблюдаемых OTU (OTU obs = OTU, наблюдаемых из 6000 последовательностей каждого образца) в качестве индикатора бактериального богатства и рассчитали непараметрический индекс Шеннона (Ĥ), чтобы указать более широкий альфа разнообразие (то есть как богатство, так и равномерность) (Chao and Shen, 2003).Из-за ненормального распределения многих наборов данных по альфа-разнообразию мы использовали подписанные ранговые тесты Краскела-Уоллиса, Манна-Уитни и Уилкоксона для оценки влияния пола, возраста, идентичности гнезда и органа на богатство и однородность микробиоты ( PAST, v.3.11) (Hammer et al., 2001). Учитывая, что многие фоновые факторы могут варьироваться в зависимости от индивидуальных гнезд (например, степень экстрапарного поведения при спаривании, различия в качестве среды обитания и / или отцовские инвестиции), мы рассматривали взрослых самцов и самок в гнездах, а также птенцов и взрослых особей в гнездах, как сопоставимые. парные наблюдения при оценке влияния пола и возраста.Корреляции оценивали с использованием коэффициентов корреляции Спирмена ( r s ). Необработанные значения p представлены для одномерного анализа (Gotelli and Ellison, 2004).

    Для анализа бета-разнообразия одноэлементные (т. Е. OTU, представленные одной последовательностью) и дуплетонные (т. Е. OTU, представленные двумя последовательностями) OTU были удалены из набора данных, и для каждой из оставшихся OTU была определена согласованная таксономия ( N = 2825) с использованием консервативного доверительного порога 80% (Claesson et al., 2009). Таксономические обозначения и необработанные данные подсчета для каждой из этих OTU по выборке представлены в качестве дополнительных материалов (Supplemental Data 1). Состав и структура микробиоты были охарактеризованы с использованием индексов экологического сходства Дайса (т.е. Соренсена) и Брея-Кертиса, соответственно (PAST, v.3.11). Графики основных координат (PCoA) были созданы для визуализации вариаций микробиоты среди образцов, а влияние пола, возраста, идентичности гнезда и органа на состав и структуру микробиоты оценивалось с использованием как анализа сходства (ANOSIM), так и непараметрического анализа MANOVA (PAST , v.3.11; 9999 перестановок). Различия в дисперсии между группами оценивались с использованием отклонений от пространственных медиан и перестановок наименьших абсолютных отклонений (PERMDISP2; 9999 перестановок) (Anderson, 2006). При необходимости, анализ процентного сходства (SIMPER) проводился для выяснения вклада конкретных OTU в наблюдаемую вариацию на уровне сообщества. Тесты Mantel были использованы для оценки силы ковариации между микробиотой клоаки и уропигиальных желез, а также между бактериальным и летучим профилями уропигиальных желез (PAST, v.3.11; 9999 перестановок). Необработанные значения p представлены для всех многомерных перестановочных тестов (Gotelli and Ellison, 2004; Hammer, 2015). Тепловые карты были созданы с использованием Matrix2png (Павлидис и Нобл, 2003).

    ГХ-МС анализ проб масла Preen

    Наши методы ГХ-МС были описаны ранее (Whittaker et al., 2010, 2011; Soini et al., 2013). Мы экстрагировали летучие соединения из образцов очищенного масла с помощью мешалки Twister ® и провели количественный анализ с помощью газового хроматографа Agilent 6890N, подключенного к масс-спектрометру 5973i MSD (Agilent Technologies, Inc., Wilmington, DE) с автосамплером для термодесорбции и охлаждаемой системой впрыска (TDSA-CIS 4 от Gerstel GmbH, Мюльхайм-ан-дер-Рур, Германия). Все основные соединения были идентифицированы сравнением со стандартами от Sigma-Aldrich Chemical Company (Сент-Луис, Миссури) с использованием масс-спектров и времени удерживания. Площади пиков интересующих соединений были нормализованы путем деления площади каждого пика на площадь внутреннего стандарта (7-тридеканон) в соответствующих опытах с получением относительных концентраций (то есть относительных количеств на 1.0 мг очищающего масла). Относительное стандартное отклонение (RSD, мера воспроизводимости) площади пика внутреннего стандарта составило 13% ( N = 12).

    Концентрация летучих соединений масла Preen меняется в краткосрочной перспективе в зависимости от таких факторов, как условия разведения и изменения уровня гормонов (Whittaker et al., 2011). Напротив, пропорции тех соединений, которые составляют общую смесь, очень воспроизводимы и отражают индивидуальную идентичность (Whittaker et al., 2010). Мы преобразовали измерения в пропорции, разделив наблюдаемую площадь пиков каждого соединения на сумму пиков всех соединений.Графики PCoA использовались для визуализации изменчивой вариации профиля среди образцов, а влияние пола, возраста и идентичности гнезда на структуру профиля оценивалось с использованием анализа сходства (ANOSIM) и непараметрического MANOVA. Анализы SIMPER были проведены для выяснения вклада конкретных летучих соединений в наблюдаемые различия в профилях.

    Результаты

    Альфа-разнообразие микробиоты Junco

    Альфа-разнообразие клоакальной микробиоты взрослых было больше, чем микробиота уропигиальных желез (тест Вилкоксона; N = 17; OTU obs : W = 148, p = 0.0002; Ĥ: W = 145, p = 0,0004). У птенцов таких различий не наблюдалось ( N = 26; ОТУ obs : W = 201, p = 0,517; Ĥ: W = 199, p = 0,551). Альфа-разнообразие микробиоты клоаки и уропигиальных желез не различается у мужчин и женщин среди взрослых (тест Вилкоксона; N m = 8, N f = 8; OTU obs : W = 23, p = 0.549; Ĥ: W = 22, p = 0,642) или птенцов (тест Манна-Уитни; N м = 11, N f = 15; OTU obs : U = 78,5, p = 0,849; Ĥ: U = 56, p = 0,180). Не было влияния возраста на альфа-разнообразие клоакальной микробиоты (критерий Вилкоксона для средних значений по возрастным классам на гнездо, N = 9; OTU obs : W = 24, p = 0.910; Ĥ: W = 30, p = 0,427; Фигура 2). Однако богатство микробиоты мочевых желез (OTU obs : W = 44, p = 0,010) различается между взрослыми особями и птенцами, причем у птенцов она выше, чем у взрослых (Рисунок 2).

    Рис. 2. Сравнение сходства между (A) богатством (наблюдаемые OTU) и (B) более широким альфа-разнообразием (непараметрический индекс Шеннона) микробиоты клоаки и уропигиальных желез взрослых и птенцов юнко .Сравнения между возрастными классами отражают средние значения для пар по гнезду (** p ≤ 0,01).

    Среди взрослых людей альфа-разнообразие микробиоты клоаки и уропигиальных желез не всегда различается между гнездами (тест Краскела-Уоллиса; клоака: OTU obs : H = 9,201, p = 0,239;: H = 7,5, p = 0,379; уропигиальная железа: OTU obs : H = 12,05, p = 0,099; Ĥ: H = 11,74, p = 0.110). Среди птенцов альфа-разнообразие микробиоты уропигиальных желез также не различается между гнездами (OTU obs : H = 8,003, p = 0,433;: H = 8,239, p = 0,410). Однако на насыщенность и равномерность микробиоты клоаки влияла идентичность гнезда (OTU obs : H = 18,24, p = 0,019;: H = 20,41, p = 0,009). Богатство микробиоты птенцов клоаки (OTU obs : r s = 0.589, p = 0,002) положительно коррелировали с таковой их матери, но не их отца (OTU obs : r s = 0,330, p = 0,133).

    Бета-разнообразие микробиоты Junco: сравнение клоаки и уропигиальных желез

    Состав (ANOSIM: R = 0,107, p = 0,002; NPMANOVA: F = 1,595, p = 0,002; Рисунок 3), но не структура (ANOSIM: R = 0.039, p = 0,098; NPMANOVA: F = 1,332, p = 0,123), микробиоты клоаки и мочеполовой железы у взрослых различались. Двадцать девять OTU присутствовали по крайней мере в половине клоак и половине уропигиальных желез взрослых, 28 OTU присутствовали по крайней мере в половине клоак, но не в половине уропигиальных желез, и только одна OTU присутствовала в по меньшей мере в половине уропигиальных желез, но не в половине клоак (Proteobacteria: Salinisphaera ; дополнительные данные 1).В сочетании с приведенными выше результатами по альфа-разнообразию клоакальной микробиоты, чем уропигиальной, это позволяет предположить, что микробиота уропигиальной железы является подмножеством более широкой микробиоты клоаки взрослых юнко. Ни состав (ANOSIM: R = -0,034, p = 0,970; NPMANOVA: F = 0,705, p = 0,981), ни структура (ANOSIM: R = -0,032, p = 0,976 ; NPMANOVA: F = 0.483, p = 0.994) микробиоты клоаки и мочеполовой железы у птенцов различались.

    Рис. 3. График PCoA, иллюстрирующий разделение по составу (сходство в кости) между клоакальной (светлые треугольники) и уропигиальной железой (закрашенные треугольники) микробиотой взрослых юнко .

    Состав и структура микробиоты клоаки и уропигиальных желез не различались между самцами и самками как среди взрослых, так и среди птенцов (Таблица S1). Однако имелось влияние возраста и особенностей гнезда на бета-разнообразие микробиоты клоаки и уропигиальных желез (Таблица 1; Рисунок 4).Анализ SIMPER показал, что не было конкретных ОТЕ, ответственных за большинство наблюдаемых различий между взрослыми особями и птенцами; скорее, многие OTU имели скромное влияние (дополнительные данные 2; рисунки S1, S2). Состав железистой микробиоты среди птенцов не был более изменчивым, чем у взрослых особей (PERMDISP; клоака: p = 0,168; уропигий: p = 0,166; рисунки 4A, B).

    Таблица 1. Анализ с целью оценки вариации состава (сходство игральных костей) и структуры (сходство Брея-Кертиса) микробиоты клоаки и уропигиальных желез на основе возрастного класса и идентичности гнезда .

    Рис. 4. Графики PCoA, иллюстрирующие разделение (A, B) состава (сходство Дайса) и (C, D) структуры (сходство Брея-Кертиса) микробиоты клоаки и уропигиальной железы юнко на основе возрастного класса и идентичности гнезда . Закрытые кружки обозначают взрослых особей, а белые кружки — птенцов. Цветовая кодировка отражает идентичность гнезда.

    Бета-разнообразие микробиоты Junco: Cloaca

    Клоакальная микробиота птенцов была более похожа на микробиоту своих родителей как по составу, так и по структуре, чем микробиота уропигиальных желез птенцов на соответствующую микробиоту их родителей (тест Вилкоксона; мать: состав: W = 275, p = 0.011, структура: W = 262, p = 0,028; отец: состав: W = 209, p = 0,006, структура: W = 207, p = 0,007). Состав клоакальной микробиоты птенцов был одинаково похож на микробиоту их матери и социального отца (критерий Вилкоксона; N = 22; W = 140, p = 0,679; рисунок 5A), но наблюдалась тенденция к структура клоакальной микробиоты птенцов должна быть больше похожа на микробиоту матери, чем отца ( W = 185, p = 0.059; Рисунок 5B). В целом микробиота клоаки птенцов была более схожей по составу ( N = 26; W = 345, p <0,0001) и структуре ( W = 286, p = 0,005). взрослые самки, чем взрослые самцы юнко в более широкой популяции (т. е. исключая родителей птенцов; рис. 5). Тем не менее микробиота клоаки птенцов была больше похожа на микробиоту их матери, чем у других взрослых самок (состав: W = 282, p = 0.007; структура: W = 328, p = 0,0001) и больше похожа на структуру своего отца, чем другие взрослые мужчины (состав: W = 197, p = 0,021; структура: W = 212, p = 0,004; рисунок 5). То, был ли сопутствующий взрослый самец отцом или нет его птенцам, не влияло на состав (критерий Манна-Уитни; N родитель = 11, N notsire = 11; U = 57, p = 0.847) или структурное ( U = 56, p = 0,793) сходство их клоакальной микробиоты. Кроме того, среднее сходство клоакальной микробиоты птенцов не различается между полными братьями и сестрами гнездами, содержащими полных братьев и сестер (тест Манна-Уитни; N полный = 4, N половина = 5; состав: U = 9, p = 0,905; структура: U = 7, p = 0,556).

    Рисунок 5.Сравнение сходства между (A) составом и (B) микробиотой клоаки и уропигиальной железы птенцов юнко с микробиотой их собственных матери и отца, а также других взрослых самок и самцов в популяции (* p ≤ 0,05; ** p ≤ 0,01; *** p ≤ 0,001) . Образцы, окрашенные в серый цвет, обозначают 4 птенца, у которых не было сопровождающего отца.

    Бета-разнообразие микробиоты Junco: уропигиальная железа

    Оба состава (тест Вилкоксона; N = 23; W = 234, p = 0.002) и структура ( W = 256, p <0,0001) микробиоты мочеполовых желез птенцов были более похожи на соответствующую микробиоту их матери, чем отца (Рисунок 5). Как и в случае клоакальной микробиоты, уропигиальная микробиота птенцов была более схожей по составу ( N = 27; W = 370, p <0,0001) и структуре ( W = 378, p <0,0001), к таковым взрослых самок, чем самцов юнко, в более широкой популяции (рис. 5).Уропигиальная микробиота птенцов была больше похожа на соответствующую микробиоту их матери, чем на микробиоту других взрослых самок в популяции ( N = 27; состав: W = 320, p = 0,002; структура: W = 321, p = 0,002; рисунок 5). Этого не произошло с их отцом и другими взрослыми мужчинами ( N = 23; состав: W = 185, p = 0,160; структура: W = 172, p = 0.315). Как и в случае с клоакальной микробиотой, то, был ли сопутствующий самец отцом своего детеныша или нет, не влиял на композиционное или структурное сходство их уропигиальной микробиоты (тест Манна-Уитни; N родитель = 12, N notsire = 11; состав: U = 47, p = 0,260; структура: U = 53, p = 0,449), и не было различий в сходстве состава или структуры уропигиальной микробиоты между полнородные и полусибские гнезда (тест Манна-Уитни; N полное = 4, N половина = 5; состав: U = 10, p = 1.000; состав: U = 9, p = 0,905).

    Бета-разнообразие летучих профилей масла Preen

    Структура летучих профилей жирного масла не различалась между мужчинами и женщинами среди взрослых ( N m = 8, N f = 9; ANOSIM: R = -0,076 , p = 0,979; NPMANOVA: F = 0,666, p = 0,880) или птенцы ( N м = 12, N f = 158; ROSIM: = -0.048, p = 0,874; НПМАНОВА: F = 1,422, p = 0,217). Однако, как и в случае с микробиотой, возраст и идентичность гнезд оказали влияние на структуру летучих профилей юнко (ANOSIM: Возраст: R = 0,55, p = 0,0002, Nest: R = 0,11, p = 0,059; NPMANOVA: Возраст: F = 5,863, p = 0,0001, Nest: F = 1,162, p = 0,042, Взаимодействие: F = 0,006, p = 0.408; Рисунок 6). Эффект гнезда был скромным; эффект возраста устойчивый. Анализ SIMPER показал, что почти половина (44%) наблюдаемых вариаций в структуре летучих профилей между взрослыми особями и птенцами была связана с более высокими пропорциями 1-ундеканола в жире взрослых особей (тест Манна-Уитни; U = 42, ). p <0,0001; 19,1%) и более высокие уровни 1-гексадеканола ( U = 96, p = 0,001; 15,8%) и 1-пентадеканола ( U = 53, p <0.0001; 9,1%) в масле птенцов (рисунок 7; дополнительные данные 2).

    Рис. 6. График PCoA, иллюстрирующий разделение в структуре летучих профилей уропигиальных желез взрослых и птенцов юнко . Закрытые кружки обозначают взрослых особей, а белые кружки — птенцов. Цветовая кодировка отражает идентичность гнезда.

    Рис. 7. Сравнение различий в процентном содержании 1-ундеканола, 1-пентадеканола и 1-гексадеканола в летучих профилях масел мочеполовых желез взрослых и птенцов (*** p ≤ 0.001) . Линии указывают медианные значения.

    Профиль летучести очищенного жира птенцов в целом был более похож на профиль их отца, чем у их матери ( N = 23; тест Вилкоксона; W = 223, p = 0,008; Рисунок 8). Более того, летучие профили птенцов были заметно больше похожи на таковые у взрослых самцов, чем у самок в более широкой популяции ( N = 27; W = 378, p <0,0001; Рисунок 8). Тем не менее, летучие профили жирного жира птенцов были более похожи на характеристики их матери, чем у других взрослых самок в популяции ( N = 27; W = 299, p = 0.008). Иначе обстоит дело с их отцами — летучие характеристики птенцов были не более похожи на характеристики их отца, чем на другие взрослые самцы в популяции ( N = 23; W = 175, p = 0,273). То, произвел ли сопутствующий отец птенца или нет, не повлияло на сходство их летучих профилей (критерий Манна-Уитни; N отец = 12, N notsire = 11; U = 59, p = 0.695). Наконец, среднее сходство летучего профиля среди птенцов не различается между гнездами, содержащими только полных братьев и сестер, и гнездами, содержащими выводки со смешанным отцовством ( N полные = 4, N половина = 5; U = 9, p = 0,905).

    Рис. 8. Сравнение сходства в структуре летучих профилей уропигиальных желез птенцов юнко с таковыми их собственных матери и отца и других взрослых самок и самцов в популяции (** p ≤ 0 .01; *** p ≤ 0,001) . Образцы, окрашенные в серый цвет, обозначают 4 птенца, у которых не было сопровождающего отца.

    Ковариация уропигиальной микробиоты и летучих профилей

    Не было никаких указаний на то, что профили летучих компонентов очищенного масла зависят от состава (тест Мантеля; N = 44; R = 0,101, p = 0,155) или структуры ( R = -0,085, p = 0,793) микробиоты уропигиальной железы. Этот результат сохраняется при рассмотрении взрослых ( N = 17; состав: R = -0.145, p = 0,711; структура: R = -0,129, p = 0,602) и птенцы ( N = 27; состав: R = 0,077, p = 0,207; структура: R = -0,002, p = 0,447) отдельно.

    Обсуждение

    Цели этого исследования заключались в оценке влияния пола, возрастного класса и идентичности гнезда на микробиоту клоаки и уропигиальных желез, а также на профили летучих уропигий, чтобы выяснить относительное влияние вариабельности окружающей среды и генетического родства на формирование юнко. микробиота и летучие профили, а также для проверки ковариации между этими профилями среди юношей.Результаты нашей характеристики микробиоты junco на уровне филумов соответствовали исследованиям микробиоты птиц в целом: они были представлены Proteobacteria, Firmicutes, Actinobacteria и Bacteroidetes (Hird et al., 2014; Waite and Taylor, 2015). В частности, наши данные на уровне рода согласуются с недавним обследованием на основе культивирования юнковентральных перьевых бактерий, которое включало Proteobacteria ( Brevundimonas, Methylobacterium, Pseudomonas, Rhizobium и Sphingomonas ) и Firmicutes ( Staphylococcus ). широко распространены и многочисленны в нашем наборе данных (Дополнительные данные 1) (Dille et al., 2016).

    Влияние секса

    Мы не обнаружили влияния пола на клоакальную или уропигиальную микробиоту, а также на уропигиальные летучие компоненты ни у взрослых особей, ни у птенцов. Этот результат был неожиданным, учитывая, что о значительных половых различиях в профилях летучих джунко сообщалось ранее (Whittaker et al., 2010) и воспроизводилось (Whittaker et al., 2013). Однако потенциальное объяснение состоит в том, что юнко в предыдущих исследованиях еще не воспроизводились в тот сезон, в то время как взрослые юнко в текущем исследовании отбирались в тот день, когда их потомство вылетало из гнезда.Также возможно, что наш меньший размер взрослой выборки ( n = 17 здесь по сравнению с 34 и 26 в предыдущих исследованиях), возможно, не обладал статистической мощностью для обнаружения половых различий в изменчивых профилях. Juncos не содержат летучих соединений, специфичных для пола, но вместо этого различаются относительными пропорциями общих соединений (Whittaker et al., 2010). Отсутствие половых различий в микробиоте может отражать совместное использование микробов между парами, как это наблюдалось у содержащихся в неволе зебровых зябликов (Kulkarni and Heeb, 2007) и свободноживущих ласточек, Hirundo rustica (Kreisinger et al., 2015). Основополагающие влияния пола и потенциально генотипа (обсуждаемого ниже) могут быть замаскированы гораздо более сильным влиянием изменений окружающей среды, включая социальное поведение. Например, генетические и половые эффекты на кишечную микробиоту цыплят-бройлеров были очевидны при обычном питании и условиях содержания (Zhao et al., 2013), но те же самые эффекты могли не проявляться в менее контролируемых сценариях.

    Эффект возраста

    Центральный вопрос в животно-микробной экологии заключается в том, как состав и структура симбиотических микробных сообществ меняются с возрастом и как эти сообщества приобретаются и формируются (van Dongen et al., 2013). В этом исследовании было выявлено влияние возраста и особенностей гнезда на микробный профиль и запахи юнко. Хотя клоакальная и уропигиальная микробиота птенцов и взрослых особей значительно различалась, различия были скромными и не одинаковыми для разных гнезд. Различия в составе микробиоты птенцов были аналогичны составу взрослых особей, и многие OTU были общими между родителями и потомством — не было OTU, которые выделялись бы как специфические для птенцов. Тем не менее микробиота птенцов мочеполовой железы была более богата ОТЕ, чем у взрослых, и это наблюдение согласуется с идеей о том, что птенцы и молодые животные в целом являются хозяевами более временных и редких симбионтов, чем взрослые животные (Palmer et al., 2007; van Dongen et al., 2013). Примечательно, что в то время как богатство и состав микробиоты клоаки и уропигиальной железы различались у взрослых, причем бактериальные сообщества уропигиальных желез, по-видимому, были подмножеством тех, что обнаружены в клоаке, микробиота двух желез не различалась у птенцов, что позволяет предположить, что клоака и мочеполовая железа птенцов еще не дает разнородных ниш для симбиотических бактерий. Одним из вероятных факторов здесь является то, что уропигиальная железа развивается на протяжении всего периода птенцов и не начинает выделять жир для чистки волос примерно до 6 дня или позже (личное наблюдение; DJW).

    Острые возрастные различия были очевидны в профилях летучих веществ масла юнко прен. У птенцов содержание 1-ундеканола значительно ниже, чем у взрослых особей. Это соединение обычно выше у взрослых женщин, чем у взрослых мужчин (Whittaker et al., 2010), и увеличивается в ответ на экзогенный тестостерон (Whittaker et al., 2011). У птенцов также были значительно более высокие пропорции 1-пентадеканола и 1-гексадеканола, ни один из которых не имеет отношения к какому-либо аспекту фенотипа взрослых особей и вместо этого может быть важен для распознавания родства (Célérier et al., 2011; Bonadonna and Sanz-Aguilar, 2012), или стимулирование родительской заботы (Mas and Kolliker, 2008; Morales and Velando, 2013).

    Влияние социальной среды и генетического родства

    Специфичные для гнезда микробные и летучие профили запаха могут отражать влияние общей окружающей среды и / или генетическое родство, и выявление этих влияний по отдельности является одним из наиболее актуальных направлений исследования микробной экологии хозяина (Spor et al., 2011; Goodrich et al. ., 2014; Org et al., 2015).Темноглазые юнко предоставляют такую ​​возможность, потому что они социально моногамны, но демонстрируют заметный уровень отцовства вне пары (Ketterson et al., 1998; Gerlach et al., 2012a, b; Atwell et al., 2014), и хотя они обеспечивают свое потомство двояким родителем, только матери вынашивают яйца и птенцов (Nolan et al., 2002). Следовательно, существуют различия в генетическом родстве между братьями и сестрами, а также между птенцами и сопутствующими отцами среди гнезд, а также существуют различия в степени физического контакта с птенцами между отцами и матерями юнко.

    Отмечено выраженное влияние идентичности гнезда на клоакальную и уропигиальную микробиоту взрослых особей и птенцов. Что касается как клоакальной, так и уропигиальной микробиоты, птенцы имели большее сходство со своей матерью, чем другие взрослые самки в популяции. Среди птенцов значения богатства клоакальной микробиоты положительно коррелировали с показателями их матерей, но не их социальных отцов, и наблюдалась тенденция к тому, что структура клоакальной микробиоты птенцов была больше похожа на микробиоту их матери, чем отца.И состав, и структура микробиоты уропигиальных желез птенцов были заметно больше похожи на микробиоту их матери, чем на их отца. Был ли сопутствующий отцом птенца их генетическим отцом, не влияло на сходство их микробиоты, равно как и вариации в генетическом родстве среди птенцов не влияли на сходство их микробиоты. В совокупности эти результаты предполагают, что характеристики микробиоты птенцов сильно отражают их непосредственное окружение, особенно социальных партнеров, с которыми они часто взаимодействуют, в первую очередь их мать (Funkhouser and Bordenstein, 2013).Здесь необходимо сделать оговорку, что мы не смогли учесть возможное прямое генетическое влияние матери на микробиоту потомства. Примечательно, однако, что такие эффекты, даже если они заметны, не могут объяснить наблюдаемое фенотипическое сходство между спаривающимися парами или между птенцами и их социальными отцами, оба из которых демонстрируют паттерны, специфичные для гнезда.

    Результаты этого исследования дополняют растущий объем литературы, свидетельствующей о том, что окружающая среда, в том числе социальная, может оказывать выраженное влияние на микробиоту клоаки и уропигиальных желез птиц (Waite and Taylor, 2015).Например, у свободноживущих ласточек-сараев спаривающиеся пары имеют сходство в их клоакальной микробиоте (Kreisinger et al., 2015), а эксперименты с дикими мокками, Rissa tridactyla и зебровыми зябликами в неволе продемонстрировали, что симбиотические бактерии легко передаются между клоаки спариваемых пар (Kulkarni, Heeb, 2007). Кроме того, эксперименты по перекрестному воспитанию синиц, Parus major и P. caeruleus , и удодов, Upupa epops , показали, что среда выращивания может превзойти видовую идентичность и генетическое родство в формировании состава микробиоты клоакальных и уропигиальных желез. соответственно (Лукас, Хиб, 2005; Руис-Родригес и др., 2014). Естественные наблюдения за паразитом птичьего расплода, коричневоголовой коровьей птицей, Molothrus ater , также показали важность среды гнезда, а также диеты в формировании развивающейся микробиоты птиц (Hird et al., 2014). Влияние диеты на микробиоту кишечника млекопитающих хорошо задокументировано (Ley et al., 2008; Xu and Knight, 2015). Хотя родители юнко обеспечивают свое потомство, рационы птенцов и взрослых часто различаются: рацион взрослых особей состоит из семян, дополненных членистоногими, тогда как рационы птенцов состоят в основном из членистоногих, особенно личинок (Nolan et al., 2002). Однако рацион взрослых особей может варьироваться в зависимости от сезона в зависимости от наличия пищи, при этом взрослые особи потребляют больше членистоногих в сезон размножения (Gashwiler and Ward, 1968). Таким образом, хотя маловероятно, что одно лишь изменение диеты могло бы объяснить специфические для гнезд изменения микробиоты клоаки и уропигиальных желез, обнаруженные в этом исследовании, безусловно, разумно предположить, что это объясняет некоторые из них.

    Также наблюдалось специфическое для гнезда влияние на профили летучих запахов юнко. Однако, в отличие от наблюдаемых закономерностей в микробиоте, летучие профили птенцов были больше похожи на характеристики их отца, чем матери, а также были больше похожи на этих взрослых самцов, чем на взрослых самок.Как отмечалось выше, это, вероятно, связано с тем, что у взрослых самок более высокая доля 1-ундеканола в их летучих профилях, чем у взрослых самцов или птенцов (Whittaker et al., 2010). Тем не менее летучие профили птенцов были более похожи на характеристики их матери, чем у других взрослых самок. Как и в случае с микробиотой уропигиальных желез, то, был ли сопутствующий отцом птенца их генетический отец, не влияло на сходство летучих профилей их очищенного жира, а генетическое родство среди птенцов также не оказывало очевидного влияния на сходство летучих профилей.Очевидно, что, как и в случае с микробиотой, среда обитания, характерная для гнезд, оказала влияние на формирование летучих профилей птенцов. Однако важно отметить, что просто потому, что лежащее в основе вариации генетического родства не очевидно на фоне ярко выраженного влияния вариаций окружающей среды, это не означает, что вариации генотипа также не влияют на микробные фенотипы и фенотипы запаха птенцов юнко — это просто означает, что его влияние гораздо меньше по величине.

    Ковариация микробных и летучих профилей

    Было высказано предположение, что вклад в химическую коммуникацию животных может быть недооцененным преимуществом симбиотических микробов (Albone, 1984; Archie and Theis, 2011; Ezenwa and Williams, 2014).Хотя эта гипотеза все чаще исследуется на млекопитающих, маркирующих запах (Zomer et al., 2009; Sin et al., 2012; Theis et al., 2013; Leclaire et al., 2014), ей уделяется меньше внимания в отношении химическая сигнализация у птиц (Whittaker, Theis, 2016). Если симбиотические микробы вносят свой вклад в профили запахов своих хозяев, то органы-хозяева, излучающие запахи, должны быть заселены сообществами вызывающих запах микробов, а профили микробных и летучих запахов органов должны совпадать.Ранее мы показали, что уропигиальные железы взрослых темноглазых юнко поддерживают бактериальные сообщества, которые включают в себя роды (например, Burkholderia, Pseudomonas ), которые, как известно, продуцируют многие летучие соединения, содержащиеся в чистом масле (Whittaker and Theis, 2016), включая два соединения , 2-тридеканон и 2-пентадеканон, с зависимостью от пола и репродуктивного успеха у этого вида (Whittaker et al., 2013). Однако здесь мы дополнительно рассмотрели микробиоту клоаки и обнаружили, что бактериальные сообщества, населяющие уропигиальную железу, являются подмножеством сообществ, населяющих клоаку.Например, Burkholderia и Pseudomonas являются общими как для клоаки, так и для мочеполовой железы — они не специфичны для жирного масла. Это открытие не исключает того, что эти и другие симбиотические микробы вносят вклад в летучие профили обеих желез, хотя эта возможность не рассматривалась.

    Наши результаты также показали, что профили микробного запаха и летучих запахов юнко-уропигиальных желез не совпадали — паттерны в составе и структуре уропигиальных микробных профилей не всегда были похожи на паттерны в структуре уропигиальных летучих профилей.Следовательно, логично сделать вывод, что изменения в бактериальных сообществах уропигиальной железы не приводят к изменениям метаболизма на уровне сообщества, которые, как следствие, изменяют профиль запаха желез (Archie and Theis, 2011; Ezenwa and Williams, 2014). Однако есть и другие возможные объяснения. Во-первых, размеры нашей выборки могли быть слишком малы для выявления ковариации. Во-вторых, в производстве летучих отдушек между отдельными типами бактерий в этих сообществах может быть достаточное количество избыточных веществ, тем самым скрывая ковариацию.Обследования генов 16S рРНК позволяют получить филогенетический снимок бактериальных сообществ в окружающей среде, но необходимо делать выводы об их метаболическом потенциале (Carlos et al., 2012; Langille et al., 2013). Наконец, взаимосвязь между типами бактерий мочевых желез и летучими одорантами может быть затруднена тем фактом, что, в отличие от желез животных, предназначенных исключительно для передачи химических сигналов, уропигиальные железы птиц выполняют множество функций, включая защиту от паразитов и патогенов, защиту перьев и терморегуляцию — симбиотические бактерии. широко высказывались предположения, что они вносят свой вклад в каждую из них (Jacob and Ziswiler, 1982; Moyer et al., 2003; Shawkey et al., 2003; Giraudeau et al., 2010; Мартин-Вивальди и др., 2010; Soler et al., 2010). Использование культивирования, метаболомного и метагеномного подходов в качестве дополнения к исследованиям генов 16S рРНК, используемым здесь, позволило бы получить более подробную информацию о метаболическом потенциале этих симбиотических сообществ (Waite and Taylor, 2015), что позволило бы более детально оценить гипотезу о том, что уропигиальная железа микробиота способствует передаче химических сигналов junco.

    Выводы

    В этом исследовании использовались одновременные молекулярные микробные исследования и химический анализ желез естественной популяции темноглазых юнко, чтобы выявить относительное влияние экологических и генетических вариаций на формирование микробных и летучих профилей запаха юнко.Наши данные показывают, что социальная среда является основным фактором индивидуальной микробиоты и структуры запаха у юнко: птицы, которые находятся в непосредственной близости и часто контактируют, развивают аналогичные профили. Сюда входят спаривающиеся пары и их птенцы. Несмотря на то, что они значительно влияют на каждую из них, вариации окружающей среды (например, воздействие микробиоты пищевых продуктов, материалов для гнезд, братьев и сестер и родителей) наиболее сильно влияют на микробиоту клоаки и мочеполовых желез; Профили летучих веществ preen oil казались менее затронутыми.Хотя лежащие в основе вариации в генотипе хозяина могут влиять на состав и структуру микробных профилей и запахов юнко, это влияние не очевидно на фоне влияния вариаций окружающей среды. Мы не нашли доказательств того, что вариации микробных профилей приводят к вариациям профилей запаха, и поэтому прямой вклад симбиотических микробов в химическую коммуникацию птиц еще предстоит продемонстрировать. Однако окончательная оценка этой гипотезы потребует более всестороннего исследования, которое предоставит подробный, не требующий выводов анализ метаболических возможностей бактериальных сообществ, связанных с уропигиальной железой юнко.

    Авторские взносы

    DW был соавтором исследования, проводил полевые исследования, проводил статистический анализ летучих соединений и был соавтором рукописи. Н.Г. провела анализ отцовства и помогла с полевыми исследованиями. SS помогала с полевыми исследованиями и анализами ГХ-МС. KC помог с анализами ГХ-МС. AW помогал с анализом последовательности и созданием рисунков. HS и MN возглавили анализ ГХ-МС. EK курировала полевые работы и долгосрочный проект junco. К.Т. был соавтором исследования, руководил анализом последовательности и соавтором рукописи.Все авторы прочитали, отредактировали и одобрили рукопись.

    Финансирование

    Этот материал частично основан на работе, поддержанной Национальным научным фондом в соответствии с Соглашением о сотрудничестве № DBI-04. Любые мнения, выводы, выводы или рекомендации, выраженные в этом материале, принадлежат авторам и не обязательно отражают точку зрения Национального научного фонда. Полевые работы были поддержаны стипендиатом для ранней карьеры Биологической станции Горного озера в DW.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Мы благодарим Университет Вирджинии, биологическую станцию ​​Маунтин-Лейк, отель Mountain Lake и семью Долинджер за разрешение исследований на их территории. Мы благодарим Эбби Киммит, Дастина Райхарда, Сару Ванамакер и Джозефа Велклина за помощь в этой области, а также Джона Дувра и Арвинда Венкатарамана за помощь в выделении ДНК и обработке последовательностей соответственно.

    Дополнительные материалы

    Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/article/10.3389/fevo.2016.00090

    Список литературы

    Albone, E. S. (1984). Семиохимия млекопитающих . Нью-Йорк, штат Нью-Йорк: Джон Вили.

    Арчи, Э.А., и Тайс, К.Р. (2011). Поведение животных соответствует микробной экологии. Anim. Behav. 82, 425–436. DOI: 10.1016 / j.anbehav.2011.05.029

    CrossRef Полный текст | Google Scholar

    Этвелл, Дж.В., Кардосо, Г. К., Уиттакер, Д. Дж., Прайс, Т. Д., Кеттерсон, Е. Д. (2014). Гормональные, поведенческие и жизненные черты демонстрируют коррелированные сдвиги по отношению к укоренению популяции в новой среде. Am. Nat. 184, E147 – E160. DOI: 10.1086 / 678398

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Болл, Г. Ф., и Кеттерсон, Е. Д. (2007). Половые различия в реакции на сигналы окружающей среды, регулирующие сезонное размножение птиц. Philos.Пер. R. Soc. Лондон. В 363, 231–246. DOI: 10.1098 / rstb.2007.2137

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Берджен Бернс, К., Росвалл, К. А., Кеттерсон, Э. Д. (2013). Нервная стероидная чувствительность и агрессия: сравнение особей двух подвидов певчих птиц. J. Evol. Биол. 26, 820–831. DOI: 10.1111 / jeb.12094

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бонадонна, Ф., и Санс-Агилар, А. (2012).Распознавание родства и предотвращение инбридинга у диких птиц: первое свидетельство распознавания запаха, связанного с индивидуальным родством. Anim. Behav. 84, 509–513. DOI: 10.1016 / j.anbehav.2012.06.014

    CrossRef Полный текст | Google Scholar

    Капорасо, Дж. Г., Лаубер, К. Л., Уолтерс, В. А., Берг-Лайонс, Д., Хантли, Дж., Фирер, Н. и др. (2012). Сверхвысокопроизводительный анализ микробного сообщества на платформах Illumina HiSeq и MiSeq. ISME J. 6, 1621–1624. DOI: 10.1038 / ismej.2012.8

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Селерье, А., Бон, К., Малаперт, А., Пальмас, П., и Бонадонна, Ф. (2011). Этикетка химического родства у морских птиц. Biol. Lett. 7, 807–810. DOI: 10.1098 / RSBL.2011.0340

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чао А. и Шен Т. Дж. (2003). Непараметрическая оценка индекса разнообразия Шеннона при наличии в выборке невидимых видов. Environ.Ecol. Стат. 10, 429–443. DOI: 10.1023 / A: 1026096204727

    CrossRef Полный текст | Google Scholar

    Клаэссон, М. Дж., О’Салливан, О., Ван, К., Никкила, Дж., Марчези, Дж. Р., Смидт, Х. и др. (2009). Сравнительный анализ пиросеквенирования и филогенетического микрочипа для изучения структур микробного сообщества в дистальном отделе кишечника человека. PLoS ONE 4: e6669. DOI: 10.1371 / journal.pone.0006669

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дэвид, Л.А., Морис, К. Ф., Кармоди, Р. Н., Гутенберг, Д. Б., Баттон, Дж. Э., Вулф, Б. Е. и др. (2014). Диета быстро и воспроизводимо изменяет микробиом кишечника человека. Природа 505, 559–563. DOI: 10.1038 / природа12820

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дэвис Т. С., Криппен Т. Л., Хофштеттер Р. В. и Томберлин Дж. К. (2013). Выбросы летучих микробов в качестве полухимикатов насекомых. J. Chem. Ecol. 39, 840–859. DOI: 10.1007 / s10886-013-0306-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дилле, Дж.В., Роджерс, К. М., Шнегурт, М. А. (2016). Выделение и характеристика бактерий из перьев диких темноглазых юнкосов ( Junco hyemalis ). Auk 133, 155–167. DOI: 10.1642 / AUK-15-126.1

    CrossRef Полный текст | Google Scholar

    Эзенва, В. О., Херардо, Н. М., Иноуэ, Д. В., Медина, М., и Ксавьер, Дж. Б. (2012). Поведение животных и микробиом. Наука 338, 198–199. DOI: 10.1126 / science.1227412

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фрауне, С.и Bosch, T.C.G. (2007). Долгосрочное поддержание видоспецифической бактериальной микробиоты у базальных многоклеточных животных Hydra . Proc. Natl. Акад. Sci. США 104, 13146–13151. DOI: 10.1073 / pnas.0703375104

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Gashwiler, J. S., and Ward, A. L. (1968). Корма Oregon junco в хвойных лесах. Murrelet 49, 29–36. DOI: 10.2307 / 3534086

    CrossRef Полный текст | Google Scholar

    Герлах, Н.М., МакГлотлин, Дж. У., Паркер, П. Г., Кеттерсон, Э. Д. (2012a). Беспорядочные половые связи дают потомство с более высокой пригодностью на протяжении всей жизни. Proc. R. Soc. B 279, 860–866. DOI: 10.1098 / rspb.2011.1547

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Герлах, Н. М., МакГлотлин, Дж. У., Паркер, П. Г. и Кеттерсон, Э. Д. (2012b). Переосмысление градиентов Бейтмана: множественное спаривание и отбор у обоих полов видов певчих птиц. Behav. Ecol. 23, 1078–1088.DOI: 10.1093 / beheco / ars077

    CrossRef Полный текст | Google Scholar

    Giraudeau, M., Czirjak, G.A., Duval, C., Bretagnolle, V., Eraud, C., McGraw, K.J., et al. (2010). Влияние ограниченного доступа к чистым железам на самообеспечение матери и репродуктивные инвестиции крякв. PLoS ONE 5: e13555. DOI: 10.1371 / journal.pone.0013555

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гудрич, Дж. К., Уотерс, Дж. Л., Пул, А. К., Саттер, Дж.Л., Корен О., Блехман Р. и др. (2014). Человеческая генетика формирует микробиом кишечника. Ячейка 159, 789–799. DOI: 10.1016 / j.cell.2014.09.053

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Готелли, Н. Дж., И Эллисон, А. М. (2004). Учебник по экологической статистике . Сандерленд: Sinauer Associates, Inc.

    Google Scholar

    Hacquard, S., Garrido-Oter, R., González, A., Spaepen, S., Ackermann, G., Lebeis, S., et al.(2015). Микробиота и питание хозяев в царствах растений и животных. Клеточный микроб-хозяин 17, 603–616. DOI: 10.1016 / j.chom.2015.04.009

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хаммер, О. (2015). PAST: Справочное руководство по палеонтологической статистике , версия 3.06. Осло: Музей естественной истории.

    Хаммер О., Харпер Д. А. Т. и Райан П. Д. (2001). ПРОШЛОЕ: Пакет программ ПАлеонтологической статистики для обучения и анализа данных. Palaeontol. Электрон 4, 1–9.

    Хирд С. М., Карстенс Б. К., Кардифф С. В., Диттманн Д. Л. и Брамфилд Р. Т. (2014). Местонахождение выборки более заметно, чем таксономия или экология, в кишечной микробиоте паразитирующей на выводке коричневоголовой коровьей птице (Molothrus ater). Peer J 2: e321. DOI: 10.7717 / peerj.321

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джейкоб, Дж. П., и Зисвайлер, В. (1982). «Уропигиальная железа», в Avian Biology , ред.С. Фарнер, Дж. Р. Кинг и К. К. Паркс (Нью-Йорк, Нью-Йорк: Academic Press), 199–324.

    Калиновски С., Тапер М. Л. и Маршалл Т. К. (2007). Пересмотр того, как компьютерная программа CERVUS устраняет ошибку генотипирования, увеличивает успех в установлении отцовства. Мол. Ecol. 16, 1099–1106. DOI: 10.1111 / j.1365-294X.2007.03089.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кеттерсон, Э. Д., Нолан, В. мл., Касто, Дж. М., Беркл, К. А., Клотфельтер, Э.Д., Гриндстафф, Дж. Л. и др. (2001). «Тестостерон, фенотип и приспособленность: программа исследований в области эволюционной поведенческой эндокринологии», в Avian Endocrinology , ред. А. Доусон и М. Чатурведи (Нью-Дели: издательство Narosa), 19–40.

    Кеттерсон, Э. Д., Паркер, П. Г., Рауф, С. А., Нолан, В. мл., Зигенфус, К., и Чандлер, К. Р. (1998). «Относительная важность экстра-парных оплодотворений для репродуктивного успеха самцов и самок у темноглазых юнко ( Junco hyemalis )» в «Репродуктивная тактика птиц: перспективы самок и самцов» , ред.Дж. Паркер и Н. Т. Берли (Лоуренс, Канзас: Союз американских орнитологов), 81–101.

    Кломп, Дж. Э., Мерфи, М. Т., Бартос Смит, С., Маккей, Дж. Э., Феррера, И., и Рейзенбах, А., Л. (2008). Клоакальные микробные сообщества самок пятнистой собаки Pipilo maculatus : микрогеографические изменения и индивидуальные источники изменчивости. J. Avian Biol. 39, 530–538. DOI: 10.1111 / j.0908-8857.2008.04333.x

    CrossRef Полный текст | Google Scholar

    Козич, Ю.Дж., Весткотт, С. Л., Бакстер, Н. Т., Хайлендер, С. К., и Шлосс, П. Д. (2013). Разработка стратегии двухиндексного секвенирования и конвейера курации для анализа данных последовательности ампликонов на платформе секвенирования MiSeq Illumina. Заявл. Environ. Microbiol. 79, 5112–5120. DOI: 10.1128 / AEM.01043-13

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Крайзингер, Дж., Цижкова, Д., Кропацкова, Л., и Альбрехт, Т. (2015). Структура микробиома клоаки у перелетных птиц на большие расстояния, оцененная с помощью глубокого пиросеквенирования 16sРНК. PLoS ONE 10: e0137401. DOI: 10.1371 / journal.pone.0137401

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лангиль, М. Г. И., Заневельд, Дж., Капорасо, Дж. Дж., Макдональд, Д., Найтс, Д., Рейес, Дж. А., и др. (2013). Прогнозирующее функциональное профилирование микробных сообществ с использованием последовательностей маркерного гена 16S рРНК. Нат. Biotechnol. 31, 814. DOI: 10.1038 / nbt.2676

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Леклер, С., Нильсен, Дж. Ф., и Дреа, К. М. (2014). Бактериальные сообщества в секретах анального запаха сурикатов различаются в зависимости от пола, возраста и принадлежности к группе хозяина. Behav. Ecol. 25, 996–1004. DOI: 10.1093 / beheco / aru074

    CrossRef Полный текст | Google Scholar

    Ли, С., Сун, Дж., Ли, Дж., И Ко, Г. (2011). Сравнение микробиоты кишечника здоровых взрослых близнецов, проживающих в Южной Корее и США. Заявл. Environ. Microb. 77, 7433–7437. DOI: 10.1128 / AEM.05490-11

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лей, Р.Э., Лозупоне, К. А., Хамади, М., Найт, Р., и Гордон, Дж. И. (2008). Миры внутри миров: эволюция микробиоты кишечника позвоночных. Нат. Rev. Microbiol. 6, 776–788. DOI: 10.1038 / nrmicro1978

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лонгмайр, Дж. Л., Джи, Г. Ф., Ханденкипф, О. Л., и Марк, Г. А. (1992). Установление отцовства у американских журавлей, Grus americana , с помощью анализа ДНК. Auk 109, 522–529.

    Google Scholar

    Лукас, Ф.С., и Хиб П. (2005). Факторы окружающей среды формируют сообщества клоакальных бактерий у птенцов большой синицы Parus major и лазоревки P. caeruleus . J. Avian Biol. 36, 510–516. DOI: 10.1111 / j.0908-8857.2005.03479.x

    CrossRef Полный текст | Google Scholar

    Мартин-Вивальди, М., Пенья, А., Перальта-Санчес, Х.М., Санчес, Л., Анано, С., Руис-Родригес, М. и др. (2010). Антимикробные химические вещества в выделениях удода вырабатываются симбиотическими бактериями. Proc. R. Soc. В 277, 123–130.

    PubMed Аннотация | Google Scholar

    Мартин-Вивальди, М., Руис-Родригес, М., Солер, Дж. Дж., Перальта-Санчес, Дж. М., Мендес, М., Вальдивия, Э. и др. (2009). Сезонные, половые различия и различия в развитии удода Upupa epops Морфология и секреция сережек: доказательства роли бактерий. J. Avian Biol. 40, 191–205. DOI: 10.1111 / j.1600-048X.2009.04393.x

    CrossRef Полный текст | Google Scholar

    Мас, Ф.и Колликер М. (2008). Материнская забота и попрошайничество потомства у социальных насекомых: химическая сигнализация, гормональная регуляция и эволюция. Anim. Behav. 76, 1121–1131. DOI: 10.1016 / j.anbehav.2008.06.011

    CrossRef Полный текст | Google Scholar

    Макфолл-Нгаи, М., Хадфилд, М.Г., Бош, Т.С.Г., Кэри, Х.В., Домазет-Лошо, Т., Дуглас, А.Э. и др. (2013). Животные в бактериальном мире — новый императив для наук о жизни. Proc. Natl. Акад. Sci. СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ. 110, 3229–3236. DOI: 10.1073 / pnas.1218525110

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Моралес, Дж., И Веландо, А. (2013). Сигналы в семейных конфликтах. Anim. Behav. 86, 11–16. DOI: 10.1016 / j.anbehav.2013.04.001

    CrossRef Полный текст | Google Scholar

    Мойер Б. Р., Рок А. Н. и Клейтон Д. Х. (2003). Экспериментальное испытание важности очищенного масла у горных голубей (Columba livia). Auk 120, 490–496.DOI: 10.1642 / 0004-8038 (2003) 120 [0490: ETOTIO] 2.0.CO; 2

    CrossRef Полный текст | Google Scholar

    Нолан В. мл., Кеттерсон Э. Д., Кристол Д. А., Роджерс К. М., Клотфелтер Э. Д., Титус Р. и др. (2002). Джунко темноглазая (Junco hyemalis) , Vol. 716. Филадельфия, Пенсильвания: Птицы Северной Америки, Inc.

    Org, E., Parks, B. W., Joo, J. W. J., Emert, B., Schwartzman, W., Kang, E. Y., et al. (2015). Генетический и экологический контроль взаимодействия микробиоты кишечника и хозяина. Genome Res. 25, 1558–1569. DOI: 10.1101 / gr.1.115

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Палмер К., Бик Э. М., ДиДжиулио Д. Б., Релман Д. А. и Браун П. О. (2007). Развитие кишечной микробиоты младенца у человека. PLoS Biol. 5: e177. DOI: 10.1371 / journal.pbio.0050177

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Петерсон, М. П., Уиттакер, Д. Дж., Амбрет, С., Сурешандра, С., Buechlein, A., Podicheti, R., et al. (2012). De novo секвенирование транскриптома у певчей птицы, темноглазого юнко ( Junco hyemalis ): геномные инструменты для системы экологических моделей. BMC Genomics 13: 305. DOI: 10.1186 / 1471-2164-13-305

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Роуэн, W. (1925). Связь света с миграцией птиц и изменениями в развитии. Природа 115, 494–495. DOI: 10.1038 / 115494b0

    CrossRef Полный текст | Google Scholar

    Руис-де-Кастаньеда, Р., Вела, А. И., Лобато, Э., Брионес, В., и Морено, Дж. (2011a). Бактериальные нагрузки на скорлупу мухоловки-пеструшки: экологические и материнские факторы. Кондор 113, 200–208.

    Google Scholar

    Руис-де-Кастаньеда, Р., Вела, А. И., Лобато, Э., Брионес, В., и Морено, Дж. (2011b). Распространенность потенциально патогенных культивируемых бактерий на яичной скорлупе и в клоаках самок мухоловок-пеструшек в среде обитания с умеренным климатом в центральной Испании. J. Field Ornithol. 82, 215–224.

    Google Scholar

    Руис-Родригес, М., Солер, Дж. Дж., Мартин-Вивальди, М., Мартин-Платеро, А. М., Мендес, М., Перальта-Санчес, Дж. М. и др. (2014). Факторы окружающей среды формируют сообщество симбионтов в уропигиальной железе удода больше, чем генетические факторы. Заявл. Environ. Microb. 80, 6714–6723. DOI: 10.1128 / AEM.02242-14

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Солтер, С. Дж., Кокс, М. Дж., Турек, Э. М., Калус, С. Т., Cookson, W.O., Moffatt, M.F., et al. (2014). Загрязнение реагентов и лабораторий может критически повлиять на анализ микробиома, основанный на последовательностях. BMC Biol. 12:87. DOI: 10.1186 / s12915-014-0087-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Sambrook, E., Fritsch, E.P., and Maniatis, T. (1989). Молекулярное клонирование: лабораторное руководство . Колд-Спринг-Харбор, Нью-Йорк: Лаборатория Колд-Спринг-Харбор.

    Google Scholar

    Schloss, P.Д., Весткотт, С. Л., Рябин, Т., Холл, Дж. Р., Хартманн, М., Холлистер, Э. Б. и др. (2009). Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом, для описания и сравнения микробных сообществ. Заявл. Environ. Microbiol. 75, 7537–7541. DOI: 10.1128 / AEM.01541-09

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шоу, К. Л., Раттер, Дж. Э., Остин, А. Л., Гарвин, М. К., и Уилан, Р. Дж. (2011). Летучие и полулетучие соединения в уропигиальном секрете серых кошачьих варьируются в зависимости от возраста и в зависимости от места гнездования и зимовки. J. Chem. Ecol. 37, 329–339. DOI: 10.1007 / s10886-011-9931-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шоуки, М. Д., Пиллаи, С. Р., Хилл, Г. Э. (2003). Химическая война? Воздействие уропигиального масла на бактерии, разрушающие перо. J. Avian Biol. 34, 345–349. DOI: 10.1111 / j.0908-8857.2003.03193.x

    CrossRef Полный текст | Google Scholar

    Син, Ю. В., Буешинг, К. Д., Берк, Т., и Макдональд, Д. В. (2012).Молекулярная характеристика микробных сообществ в секрете субкаудальных желез европейского барсука ( Meles meles ). FEMS Microbiol. Ecol. 81, 648–659. DOI: 10.1111 / j.1574-6941.2012.01396.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Слоун, В. Т., Ланн, М., Вудкок, С., Хед, И. М., Ни, С., и Кертис, Т. П. (2006). Количественная оценка роли иммиграции и случайностей в формировании структуры сообщества прокариот. Environ.Microbiol. 8, 732–740. DOI: 10.1111 / j.1462-2920.2005.00956.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сойни, Х. А., Шрок, С. Э., Брюс, К. Э., Вислер, Д., Кеттерсон, Э. Д. и Новотны, М. В. (2007). Сезонные колебания в профилях летучих соединений секрета чистящих желез темноглазого юнко ( Junco hyemalis ). J. Chem. Ecol. 33, 183–198. DOI: 10.1007 / s10886-006-9210-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сойни, Х.А., Уиттакер, Д. Дж., Вислер, Д., Кеттерсон, Э. Д., и Новотны, М. (2013). Разнообразие хемосигналов у певчих птиц: хроматографическое профилирование летучих веществ, содержащихся в чистом масле, у разных видов. J. Chromatogr. А 1317, 186–192. DOI: 10.1016 / j.chroma.2013.08.006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Солер, Дж. Дж., Мартин-Вивальди, М., Перальта-Санчес, Дж. М., и Руис-Родригес, М. (2010). Бактерии, продуцирующие антибиотики, как возможное средство защиты птиц от патогенных микроорганизмов. Откройте Орнитол. J. 3, 93–100. DOI: 10.2174 / 1874453201003010093

    CrossRef Полный текст | Google Scholar

    Спор А., Корен О., Лей Р. (2011). Выявление влияния окружающей среды и генотипа хозяина на микробиом кишечника. Нат. Rev. Microbiol. 9, 279–290. DOI: 10.1038 / nrmicro2540

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тайс, К. Р., Венкатараман, А., Дайкус, Дж. А., Кунтер, К. Д., Шмитт-Матцен, Э.Н., Вагнер А. П. и др. (2013). Симбиотические бактерии, кажется, опосредуют социальные запахи гиены. Proc. Natl. Акад. Sci. США 110, 19832–19837. DOI: 10.1073 / pnas.1306477110

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Tung, J., Barreiro, L. B., Burns, M. B., Grenier, J.-C., Lynch, J., Grieneisen, L.E., et al. (2015). Социальные сети предсказывают состав кишечного микробиома диких павианов. eLife 4: e05224. DOI: 10.7554 / elife.05224

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тернбо, П.Дж., Хамади, М., Яцуненко, Т., Кантарел, Б. Л., Дункан, А., Лей, Р. Э. и др. (2009). Основной микробиом кишечника у тучных и худых близнецов. Природа 457, 480–484. DOI: 10.1038 / nature07540

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    van Dongen, W. F. D., White, J., Brandl, H. B., Moodley, Y., Merkling, T., Leclaire, S., et al. (2013). Возрастные различия в микробиоте клоаки дикого вида птиц. BMC Ecol. 13:11. DOI: 10.1186 / 1472-6785-13-11

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван, К., Гаррити, Г. М., Тидже, Дж. М., и Коул, Дж. Р. (2007). Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии. Заявл. Environ. Microbiol. 73, 5261–5267. DOI: 10.1128 / AEM.00062-07

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Вестнит, Д. Ф., и Рэмбо, Т. Б. (2000). При копуляции самки краснокрылых дроздов подвергаются воздействию бактерий в мужской сперме. J. Avian Biol. 31, 1–7. DOI: 10.1034 / j.1600-048x.2000.310101.x

    CrossRef Полный текст | Google Scholar

    White, J., Mirleau, P., Danchin, E., Mulard, H., Hatch, S.A., Heeb, P., et al. (2010). Бактерии, передающиеся половым путем, поражают клоаки самок у дикой птицы. Ecol. Lett. 13, 1515–1524. DOI: 10.1111 / j.1461-0248.2010.01542.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Уиттакер, Д. Дж., Герлах, Н. М., Сойни, Х. А., Новотны, М. В. (2013). Запах птицы предсказывает репродуктивный успех. Anim. Behav. 86, 697–703. DOI: 10.1016 / j.anbehav.2013.07.025

    CrossRef Полный текст | Google Scholar

    Уиттакер, Д. Дж., Сойни, Х. А., Этуэлл, Дж. У., Холларс, К., Новотны, М. В., и Кеттерсон, Э. Д. (2010). Хемосигналы певчих птиц: летучие соединения в секрете чистящих желез различаются среди людей, полов и популяций. Behav. Ecol. 21, 608–614. DOI: 10.1093 / beheco / arq033

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Уиттакер, Д.Дж., Сойни, Х. А., Герлах, Н. М., Посто, А. Л., Новотны, М. В., и Кеттерсон, Э. Д. (2011). Роль тестостерона в стимулировании сезонных изменений потенциального птичьего хемосигнала. J. Chem. Ecol. 37, 1349–1357. DOI: 10.1007 / s10886-011-0050-1

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Уиттакер, Д. Дж., И Тайс, К. Р. (2016). «Бактериальные сообщества, связанные с железами junco preen: предварительные разветвления для передачи химических сигналов», в Chemical Signals in Vertebrates 13 , eds B.А. Шульте, Т. Э. Гудвин и М. Х. Феркин (Cham: Springer International Publishing), 105–117. DOI: 10.1007 / 978-3-319-22026-0_8

    CrossRef Полный текст

    Wu, G.D., Chen, J., Hoffmann, C., Bittinger, K., Chen, Y.-Y., Keilbaugh, S.A., et al. (2011). Связывание долгосрочных диетических моделей с кишечными микробными энтеротипами. Наука 334, 105–108. DOI: 10.1126 / science.1208344

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Яцуненко, Т., Рей Ф. Э., Манари М. Дж., Трехан И., Домингес-Белло М. Г., Контрерас М. и др. (2012). Микробиом кишечника человека в зависимости от возраста и географии. Природа 486, 222–227. DOI: 10.1038 / nature11053

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhao, L., Wang, G., Siegel, P., He, C., Wang, H., Zhao, W., et al. (2013). Количественный генетический фон хозяина влияет на микробиомы кишечника цыплят. Sci. Отчет 3: 1163. DOI: 10.1038 / srep01163

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Зомер, С., Dixon, S.J., Xu, Y., Jensen, S.P., Wang, H.T., Lanyon, C.V. и др. (2009). Консенсусные многомерные методы в газовой хроматографии, масс-спектрометрии и денатурирующем градиентном гель-электрофорезе: конгенные по MHC и другие линии мышей можно классифицировать в соответствии с профилями летучих веществ и микрофлоры в их запаховых метках. Аналитик 134, 114–123. DOI: 10.1039 / B807061J

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сравнительный транскриптомный и гистоморфологический анализ тканей семенников уток мулардов и пекинских уток

    Arch Anim Breed.2020; 63 (2): 303–313.

    , 1, 2 , 2 , 3 , 4 , 2 , 2 , 2 , 3 , 1 и 2

    Ли Ли

    1 Колледж наук о жизни, Фуцзянский университет сельского хозяйства и лесоводства, Фучжоу 350002, Китай,

    2 Институт животноводства и ветеринарной медицины, Академия Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    Linli Zhang

    2 Институт животноводства и ветеринарной медицины, Академия Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    Чжэнхун Чжан

    3 Колледж естественных наук, Педагогический университет Фуцзянь, Фучжоу 350007, Китай,

    Немат О.Кейхани

    4 Отдел микробиологии и клеточных исследований, Институт пищевых продуктов и Сельскохозяйственные науки, Университет Флориды, Гейнсвилл, Флорида 32611, США,

    Qingwu Xin

    2 Институт животноводства и ветеринарной медицины, Академия Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    Чжунвэй Мяо

    2 Институт животноводства и ветеринарной медицины Академии Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    Чжимин Чжу

    2 Институт животноводства и ветеринарной медицины, Академия Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    Чжэнчао Ван

    3 Колледж естественных наук, Педагогический университет Фуцзянь, Фучжоу 350007, Китай,

    Цзюньчжи Цю

    1 Колледж естественных наук, Фуцзянский университет сельского хозяйства и лесоводства, Фучжоу 350002, Китай,

    Нэнчжу Чжэн

    2 Институт животноводства и ветеринарной медицины Академии Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    1 Колледж естественных наук, Университет сельского и лесного хозяйства Фуцзянь, Фучжоу 350002, Китай,

    2 Институт животноводства и ветеринарной медицины, Академия Фуцзянь сельскохозяйственных наук, Фучжоу 350013, Китай,

    3 Колледж естественных наук, Педагогический университет Фуцзянь, Фучжоу 350007, Китай,

    4 Отдел микробиологии и клеточных исследований, Институт пищевых продуктов и Сельскохозяйственные науки, Университет Флориды, Гейнсвилл, Флорида 32611, США,

    Автор, ответственный за переписку.

    Поступило 19.12.2019; Принято 2020 6 июля.

    Заявление о доступности данных

    Исходные данные были загружены в базу данных Sequence Read Archive (SRA) (, доступ: PRJNA657980, Фуцзянская академия сельскохозяйственных наук, 2020).

    Реферат

    Транскриптомы яичек были проанализированы для характеристики гены муларда и пекинской утки экспрессируются по-разному, что помочь установить наборы данных экспрессии генов, чтобы помочь в дальнейшем определении механизмов генетического бесплодия уток-мулардов.Парафиновые секции были сделаны для сравнения различий в развитии ткани семенников между утки муларды и пекинские. Сравнительное секвенирование транскриптомов яичек тканей, и экспрессия генов-кандидатов была подтверждена с помощью количественная полимеразная цепная реакция с обратной транскрипцией (qRT-PCR). В утки-муларды, сперматогонии и сперматоциты располагались в неупорядоченном Таким образом, зрелые сперматозоиды в ткани семенников не наблюдались. Однако, разные стадии развития сперматозоидов наблюдались у семенных канальцы в ткани семенников пекинских уток.Всего 43,84 ГБ чистого чтения были собраны в 1 UniGenes. Из них 2131 стенограмма выставлено дифференциальное выражение (частота ложных обнаружений <0,001 и кратное изменение ≥2), в том числе 997 с повышенной и 1134 с пониженной регуляцией транскрипты у уток мулардов по сравнению с таковыми в семенниках пекинской утки ткани. Несколько активированных генов были связаны с репродуктивными функциями, включая рецептор рианодина 2 (RYR2), кальмодулин (CALM), аргининосукцинат синтаза и дельта-1-пирролин-5-карбоксилатсинтетаза ALDh28A1 (P5CS).Подавленные транскрипты включали специфичные для семенников серин / треонин-протеинкиназа 3, аквапорин-7 (AQP7) и глицерин-киназа ГлпК (ВГ). 10 родственных транскриптов, участвующих в биологическом развитии Процессы были идентифицированы аннотацией GO (Gene Ontology). KEGG (Киото Encyclopedia of Genes and Genomes) показали, что пероксисома рецепторы, активируемые пролифератором (PPAR), и пути передачи сигналов кальция были значимо (P <0,001) связано с нормальной физиологией яичка. Дифференциальная экспрессия избранных генов, участвующих в репродуктивной процессы проверяли с помощью qRT-PCR, что соответствовало выражению тенденция секвенирования транскриптомов (RNA-seq).Дифференциально экспрессируемые гены-кандидаты RYR2, CALM, P5CS, AQP7 и GK были идентифицированы с помощью транскрипционного анализа у муларда и пекина. утиные семенники. Это было важно для нормального развития мужского пола. репродуктивная система утки. Эти данные служат основой для дальнейшего исследование молекулярных и генетических механизмов стерильности муларда утки.

    Основные моменты. Утка мулард — межродовой стерильный гибрид. потомство от скрещивания московских и пекинских уток.В транскриптомы ткани семенников уток мулардов и пекинских систематически охарактеризованы, и дифференциально экспрессируемые гены были подвергнуты скринингу, в чтобы получить представление о потенциальных механизмах экспрессии гена гонад способствует генетическому бесплодию уток-мулардов.

    1. Введение

    Утка мулард — известный местный сорт в Китае, ценный деликатес. Утка — межродовое гибридное потомство самец Московской утки ( Cairina moschata L.) и домашней утки ( Anas platyrhynchos var. domestica ). Утка мулард демонстрирует сильный гетерозис, в том числе высокую устойчивость, высокую кормовую награду и нежное / высокое качество мяса по сравнению с его родителями. Однако не было существенных различий между внешностью самцов и самок нет очевидная дифференциация пола и сексуального поведения, а также отсутствие фактических исходных ценностей может быть определен для уток-мулардов, которые по существу непродуктивны и считаются бесплодными.

    Однако тщательное обследование показало наличие семенников номинально самцов мулардов в процессе размножения, которые произвели небольшое количество спермы, что указывает на то, что эти утки не могут быть полностью стерильными. Верно, иногда люди были идентифицированы как демонстрирующие различные аспекты нормального спаривания самцов, интромиссии или откладки яиц самками. Эти выводы предполагают, что одна из причин непродуктивного характера утки-муларда может быть связано с регуляцией экспрессии генов и дифференцировкой клеток в их репродуктивных органах, потому что отдаленно гибридизированное бесплодие — это очень сложный биологический феномен, генетическая основа которого, вероятно, регулируется разнообразными генетическими путями.Наше предыдущее исследование показало, что несовместимые кариотипы от родителей способствовали межродовому гибридизированное бесплодие из-за неправильного мейоза и плохого гонадного развития (Tan et al., 1998). В настоящее время секвенирование транскриптома (RNA-Seq) технология широко применяется для обнаружения дифференциальная экспрессия генов и функциональная аннотация у домашнего скота и домашняя птица (Chen et al., 2016; Cong et al., 2013; Liu et al., 2017; Zeng et al., др., 2015). Это включало исследования репродуктивных механизмов гены, связанные с развитием фолликулов у уток (Xu et al., 2013) и дифференциальная экспрессия генов в яичниках уток Шан Ма, которые сравнивали периоды пиковой и поздней яйцекладки (Zhu et al., 2017), а также исследование дифференциально экспрессируемых миРНК между кладкой и периоды отсутствия яйцекладки (Yu et al., 2013). Однако на сегодняшний день дифференциальный ген экспрессия не использовалась для изучения генетического механизма, который может способствуют сохранению признаков бесплодия и репродуктивной способности мулардов утки.

    Учитывая особенности стерильности уток мулардов, настоящее исследование использовали технологию RNA-Seq для сравнения транскриптомов в семенниках утки муларды и пекинские.Набор дифференциально экспрессируемых генов (ДЭГ) были проверены и охарактеризованы с помощью Gene Ontology (GO) и Kyoto Энциклопедия генов и геномов (KEGG) баз данных для функциональной аннотации и анализ для выявления генов и генетических путей, связанных с полом Фенотип дисплазии уток мулардов. Эти данные послужат основой для дальнейшее исследование механизмов аномальной дифференцировки в репродуктивная система уток мулардов и дает основу для гипотезы разработка, которая потенциально может привести к пониманию лечения или облегчение бесплодия утки муларда.

    2. Материалы и методы

    2.1. Животные

    В число экспериментальных животных входили самцы уток мулардов и пекинских. содержаться в течение 3–6 месяцев со стандартными правилами кормления в Центр лабораторных животных, Фуцзяньская академия сельскохозяйственных наук (Фуцзянь, Китай). Протокол эксперимента был одобрен Институтом животных. Комитет по уходу и использованию и Комитет по этике экспериментов на животных, Фуцзянская академия сельскохозяйственных наук. Номер утверждения комитета по этике: FAAS-IAHV-AEC-2017-0510.

    Экспериментальных уток использовали для сбора спермы в период половой зрелости (180 г. Старый). Животных не голодали в течение 12 часов в возрасте 210 дней, а затем немедленно. приносили в жертву для сбора образцов (рассечение семенников). Животные использовались утки-муларды, которые не демонстрировали верхового / сексуального поведения и Пекинские утки, которые демонстрировали нормальное поведение при восхождении. Вскрытые семенники были немедленно помещают в жидкий азот и хранят при -80 ° C до дальнейшая обработка.

    2.2. Гонадные срезы уток-мулардов и уток-пекинцев

    Были обследованы две утки-муларды и утки-пекинцы, выявлено развитие семенников. наблюдается после вскрытия.Ткани яичка зафиксированы на 10% раствор формальдегида, залитый в парафин и окрашенный гематоксилином и эозин для создания срезов тканей.

    2.3. Извлечение РНК и подготовка библиотеки для секвенирования транскриптома

    По два человека от каждой разновидности были использованы для секвенирования транскриптома и прошли биологический повторный тест, который показал, что образцы, использованные в это исследование показало хорошую биологическую воспроизводимость и приемлемый образец группировка и соблюдение требований секвенирования транскриптомов; следовательно, никаких дополнительных материалов добавлено не было.Общая РНК была выделена из яичек с помощью набора RNeasy Lipid Tissue Mini Kit (QIAGEN, Германия) следуя протоколу производителя. Были созданы библиотеки секвенирования с использованием набора для подготовки библиотеки РНК NEBNext ® Ultra ™ для анализа Illumina ® (NEB, США) в соответствии с рекомендациями производителя рекомендации, и штрих-коды были добавлены к последовательностям атрибутов для каждого образец. Чтобы выбрать фрагменты кДНК длиной ∼150–200 п.н., библиотеки очищали с использованием системы AMPure XP (Beckman Coulter, Беверли, США) с последующей амплификацией с помощью полимеразной цепной реакции (ПЦР).Качество библиотеки оценивалось с помощью системы Agilent Bioanalyzer 2100.

    2.4. Кластеризация и секвенирование

    Кластеризация образцов со штрих-кодом была выполнена на cBot Cluster Система генерации с использованием комплекта TruSeq PE Cluster Kit v3-cBot-HS (Illumina) в в соответствии с инструкциями производителя. После генерации кластера Препараты библиотеки секвенировали на платформе Illumina HiSeq 2000, и Были сгенерированы чтения с парным концом. Произведена сборка транскриптома. на основе левого fq и правого fq с использованием Trinity для определения транскрипции и уровни экспрессии генов.Анализ дифференциальной экспрессии генов двух условия / группы (мулард против Пекина) были выполнены с использованием DESeq R пакет (1.10.1). Уровни экспрессии транскрипта с скорректированным значением P равным <0,05, определенные DESeq, были обозначены как дифференциально выражено.

    2,5. Анализ обогащения GO и KEGG анализ обогащения

    Анализ обогащения GO DEG проводился с использованием верхнего GO R пакеты на основе теста Колмогорова – Смирнова. ДЭГ были классифицированы и анализируются кластерами ортологичных групп и базами данных KEGG, а P <0.05 использовался в качестве стандарта обогащения значимости.

    2.6. Количественная полимеразная цепная реакция с обратной транскрипцией

    Количественная полимеразная цепная реакция с обратной транскрипцией (qRT-PCR) была проведена для проверки четырех DEG в пулах кДНК, состоящих из по два человека от каждой группы. Праймеры для qRT-PCR были разработаны Primer Premier 6 и Beacon Designer 7.8, синтезированные компанией Bioengineering. Co., Ltd. (Шанхай). Последовательности праймеров перечислены в таблице 1. qRT-PCR была проведена при 95 ° C в течение 1 минуты, затем 40 циклов при 95 ° C в течение 15 секунд и 63 ° C в течение 25 секунд (флуоресценция коллекция).QRT-PCR проводили в 20 л реакционной смеси, содержащей 1 л шаблон кДНК, 10 л PowerUp SYBR ® Green Master Mix (Applied Biosystems {«type»: «entrez-protein», «attrs»: {«text»: «A25779», «term_id»: «86427», «term_text»: «pir || A25779»}} A25779) , 8 мкл стерильной дистиллированной воды и 0,5 мкл каждого праймера. Количество транскрипт гена-мишени относительно ген внутреннего контроля, β-актин, рассчитывалась в соответствии с ΔΔCt метод (Ливак и др., 2001). Относительные уровни мРНК были представлены как значения 2-ΔΔCt.Результаты трех для статистического анализа использовались независимые эксперименты; P <0,05 считался статистически значимым.

    Таблица 1

    Информация о праймерах для qRT-PCR.

    Ген Полное название Последовательности праймеров (от 5 ‘до 3’) Продукт Отжиг
    размер (п.н.
    ZP4 пеллюцида сперматозоиды-связывающий белок 4 F: GGCTGTGGGCTCTGGGTTT 93 60


    Р: GTTGCCATCCCATTCAAAGACAT


    CAMK4 Кальций / кальмодулин-зависимая протеинкиназа F: GCAGAAAGGGACCCAGAAACCT 109 60

    Тип IV
    Р: GTTGGGATGTGAAAGGCGAAGA


    CPCX1 центросомные белки C10orf90 гомолог F: GCAAGAAAGGCTGAAGAAGCTG 90 469 86 60

    изоформы X1
    Р: GCGCTCCTTGGTTGCTTACAG


    СПОКОЙНАЯ кальмодулин-подобный F: CCGAGGAGCAGATTGCAGAGT 150 60


    Р: CCTCGTTGATCATGTCCTGCA


    DS3 Дельта-1-пирролин-5-карбоновой кислоты синтазы F: CTGCATATAGCAATCAAATCCTTCA 85 60

    изоформы Х3
    Р: CTTACAAGTTGCACTGCATCTTTGA


    β-актина бета-актина F: GATGTGGATCAGCAAGCAGGAGT 95 60
    R: GGGTGTGGGTGTTGGTAACAGT 90 469

    3.Результат

    3.1. Срезы тканей семенников муларда и пекинской утки

    Сравнение парафиновых срезов тканей семенников муларда и пекина. утки (рис.1) показали, что семенные канальцы утки-муларда были неочевидный и имел толстую соединительную ткань. Сперматогонии и сперматоциты можно рассматривать; однако клетки неупорядочены, и зрелые сперматозоиды не наблюдаемый. В семеннике показан полный процесс сперматогенеза. срезы тканей пекинских уток. Различные стадии развития спермы наблюдались в семенных канальцах; клетки близко к стене семенные канальцы представляли собой сплюснутые примитивные клетки, большие круглые клетки были первичные / вторичные сперматоциты, а после мейоза — зрелый гаплоид. сперматозоиды располагались в центре просвета.Это раскрывает различия гонадного развития уток мулардов и пекин уровень.

    Парафиновые срезы тканей семенников утки муларда (а) и Пекин утка (б) .

    3.2. Результаты секвенирования транскриптомов тканей семенников

    Очищенные библиотеки мРНК, полученные из препарированных семенников, выделенных из муларда и Пекинские утки были сконструированы и упорядочены, как описано в Разд. 2, что дает в общей сложности 31,05 ГБ данных. После данных очистка, ∼6.34 ГБ данных для каждого условия (Всего ∼12,68 ГБ), а процент Q30 (чистая масса данных не менее 30 оснований) была выше 91,36% с GC содержание (процент оснований G и C в общем количестве оснований в чистых данных) ~ 52,24% (Таблица 2). Кроме того, соотношение отображенные чтения в транскрипты или UniGene составляли ∼68,73%, что указывает на надежность качества секвенирования.

    Таблица 2

    Сводные данные сборки секвенирования.

    Имя образца Чистое чтение Базовый номер % ≥Q30 Содержимое GC Сопоставленное считывание Сопоставленное соотношение
    T03 214696296296296276297 91.54%
    T05 21859316 6489813952 91,48% 51,88% 14983171 68,54%
    T06

    210


    9294 929 21239
    T06

    210

    21239 .36% 52,43% 14681967 69,20%

    3.3. Скрининг DEG и кластерный анализ

    FPKM (количество фрагментов на килобазу транскрипта на миллион отображенных считываний) широко используемый метод оценки уровней экспрессии генов в транскриптоме анализа данных, а коэффициент корреляции Пирсона R используется в качестве индекс оценки биологической корреляции реплик (Schulze et al., 2012). Диаграмма корреляции экспрессии генов для каждой пары биологических Повторные образцы при тех же условиях были рассчитаны (рис.2а), а надежность и повторяемость теста были очень высокими.

    (a) Корреляционная тепловая карта уровня экспрессии генов в четырех образцах. Примечания: Т03 и Т04 представляют собой две биологические копии уток Пекина; T05 и T06 представляют собой две биологические копии уток-мулардов. (b) Вулканический график дифференциально экспрессируемых генов По оси абсцисс отложено значение log2 (FPKM), т. Е. Логарифм среднего значение выражения в обоих образцах; ордината — это значение log2 (FC), логарифм разницы в экспрессии генов между двумя образцами, которые использовались для измерить различия в выражении лица.Каждая точка представляет собой ген. Зеленая точка: гены со значительно подавленной экспрессией; красная точка: гены с значительно повышенная экспрессия; черная точка: гены без дифференциала выражение. Уровень экспрессии гена с повышенной экспрессией у уток-мулардов выше, чем у уток-мулардов. что у уток по-пекински; обратное верно для гена с пониженной регуляцией.

    Коэффициент ложного обнаружения (FDR) использовался как ключевой индикатор целостности набора данных DEG, с 2131 транскриптом, идентифицированным как дифференциально выражены между двумя породами уток со стандартным FDR <0.001 и FC> 2,0. Набор данных DEG включал 997 генов, которые были более более выражен у утки-муларда, чем у утки по-пекински, и 1134 г. были более выражены у утки по-пекински, чем у утки-муларда. (Файл S1 в Приложении). Топ-20 обогащенных ДЭГ, т. Е. Более высоко экспрессированные у утки муларда, включали кальмодулин, CALM и DS3 (Таблица 3), в то время как 20 лучших обогащенных DEG в утке по-пекински включали CAMK4, CPCX1 и белок 70, содержащий домен спиральной спирали (таблица 4). Гены больше в большей степени выражены у муларда, чем у утки по-пекински, были регулятор передачи сигналов G-белка 2, потенциал-зависимый кальциевый канал L тип альфа-1D (CACNA1D), рецептор рианодина 2 (RYR2), кальмодулин (CALM), аргининосукцинатсинтаза, дельта-1-пирролин-5-карбоксилат синтетаза ALDh28A1 (P5CS) и пролиндегидрогеназа (PRODH).Гены больше выражена у пекинской утки по сравнению с уткой муларда включала белок zona pellucida, связывающий сперматозоиды 4, специфичный для семенников серин / треонин-протеинкиназа 3, тирозин-3-монооксигеназа, тучные / стволовые клетки набор рецепторов фактора роста, изоформа X1 кельч-подобного белка 10, 1-фосфатидилинозитол 4,5-бисфосфат фосфодиэстераза зета-1, арил рецептор углеводорода, потенциалзависимый кальциевый канал T типа альфа-1I (CACNA1I), фосфатидилинозитолфосфолипаза C zeta (PLCZ), фосфоламбан (PLN), альфа / бета субъединица фосфорилазы киназы (PHK), кальций / кальмодулин-зависимая протеинкиназа IV (CAMK4), кальций / кальмодулин-зависимая 3 ‘, 5’-циклическая нуклеотидфосфодиэстераза (PDE1), креатинкиназа, длинноцепочечная жирная кислота – CoA лигаза (ACSBG), аквапорин-7 (AQP7) и глицеринкиназа GlpK (GK).Эти различия были также примечателен с точки зрения глобального анализа, в котором распределение генов различия в экспрессии между образцами семенников муларда и пекинской утки были отчетливые (рис. 2б). Кластерный анализ также показал хорошие результаты. воспроизводимость и разумная группировка набора данных DEG (рис. 3).

    Тепловая карта дифференциально экспрессируемых генов. Столбцы указывают отдельные образцы, а строка представляет каждый по-разному. выраженные гены. Цветовая шкала представляет собой log10 (FPKM).Примечания: Т03 и Т04 представляют собой две биологические копии уток Пекина; T05 и T06 представляют собой две биологические копии уток-мулардов.

    Таблица 3

    Обнаружено, что верхние 20 DEG обогащены, т.е. более высоко экспрессируются утка муларда.

    970 970 970 970 952 92

    0

    92

    5827408 Up graph_c0
    Gene_ID T03_FPKM T04_FPKM T05_FPKM T06_FPKM FDR log2FC 0 175.8767 248.8426 1.42 × 10-20 10.34449418 Вверх
    c102826.graph_c0 1746
    9 0,09 10.24640925 Вверх
    c217539.graph_c0 0 0,041665 11.25527 12.3068 6,25 × 10-24 9.111506graph_c0 0,12502 0,08892 51,98331 52,81251 2,33 × 10-62 8,844165068 Вверх
    c260971.graph_c1 -55 8.816421563 Вверх
    c264446.graph_c0 0 0.115006 24.53546 19.992 6.75 × 10-19 8.75 × 10-19 Вверх
    c254097.graph_c0 0,165819 0,196564 65,71607 42,
    4,80 × 10-28 _ 4,80 × 10-28 _8,1349119 9274 9679 9.803205 10.33076 1.30 × 10-14 7.983271223 Вверх
    c263836.graph_c0 0 0,035586 2.711423 5,582583 0,000396 7,851213574 до
    c103252.graph_c0 0 0,061355 7,649744 5,202753 7,83 × 10-13 7,664124651 до
    c245722 .graph_c0 0 0,058163 5,237366 6,1

    1,23 × 10-22 7,588975803 Up
    c250240.graph_c0 0,018876 0,013426 3,124597 2,9 7,58 × 10-20 7,45381347 Вверх
    c276764.1676279 94627 94627 94627 94627 94627 94627 94627 94627 9469 -12 7,253456689 Вверх
    c271910.graph_c2 0,645458 0,879901 141,716 76,39715 3.33 × 10-10 7.064349354 Вверх
    c262074.graph_c0 0.126387 0 9.71331 6.860314 6,269 6.860314 6,269 6.860314 6,26 927 12 0,129116 0 7,887562 8,630786 4,67 × 10-17 6,869811596 Вверх
    0 c265640.graph_297627 9

    2 923555

    43,02991 30,739 2,73 × 10-36 6,785737723 до
    c257878.graph_c0 0 0,056662 2,197879 3,4 0,000237 6,738106642
    c240461.graph_c0 0,255645 0,212131 23,88739 28.60951 9,89 × 10-32 6,727028981 вверх 0,158901 0 9,133037 7,187676 1,62 × 10-18 6.542796185 вверх

    Таблица 4

    9000e в Пекинская утка.

    2896 970 9graph_c0 2746 9279 7,42 10-17 .57510716 9.137774
    32921 cgraph_c1 4_6 4_69906

    59

    946946 9276 927 927
    9276 927 927 927 94627 946279 10-20 3.4. Обогащение функций GO

    В настоящем исследовании использовался анализ базы данных GO для сравнения и аннотирования DEG в три основные классификации биологических процессов, молекулярных функции и клеточного компонента, в результате чего функциональная аннотация 786 ° (рис.4). Три основные классификации были далее разделены на всего 61 конкретная категория, состоящая из 22, 19 и 20 категорий, соответственно (рис. 4). Количество ДЭГ было больше всего в клеточном и процессы одного организма в рамках классификации биологических процессов, в категориях ячеек и частей ячеек классификации сотовых компонентов, и в связывании и каталитической активности в молекулярной функции классификация (рис. 4). Следует отметить, что в рамках биологического процесса классификации, многочисленные ДЭГ были обнаружены в категориях, относящихся к воспроизводство и репродуктивные процессы.

    GO-аннотация дифференциально экспрессируемых генов. По оси абсцисс отложена классификация ГО, по левой вертикальной оси отложена процент от количества генов, а справа — количество генов.

    3.5. Анализ обогащения пути KEGG

    Чтобы идентифицировать основные биохимические и сигнальные пути в наборе данных DEG, Проведены анализы KEGG, в результате которых ДЭГ были разделены на 93 сигнальных пути. 10 путей были значимыми при P <0,05, и наиболее значительное обогащение произошло в путях, связанных с нейроактивными лиганд-рецепторные взаимодействия, за которыми следуют кальциевые сигнальные пути, пурин метаболизм и сигнальные пути метаболизма глицеролипидов.Классификация набора данных DEG в соответствии с аннотацией генов и путями KEGG (рис. 5; Таблица 5) указывает на значительное обогащение путей, связанных с репродуктивные процессы, включенные в передачу сигналов кальция и пероксисомы рецептор, активируемый пролифератором (PPAR; рецепторы ядерных гормонов, активированные жирными кислотами) сигнальные пути (рис. 5). Шесть подавленных генов, включая CACNA1I, PLCZ, PLN, PHKA_B, CAMK4 и PDE1, и три гена с повышенной регуляцией, CACNA1D, RYR2 и CALM, которые участвуют в кальциевый сигнальный путь.Три гена с пониженной регуляцией, включая E2.7.3.2, ACSBG и AQP7, а также активированный ген для аргининосукцинатсинтазу подвергали скринингу в сигнальном пути PPAR. Кроме того, набор данных DEG показал разную степень обогащения. особенно для тех, кто связан с сигнальными путями, участвующими в размножение. Примеры включают части активированного митогеном белка. пути передачи сигналов киназы (MAPK), гонадотропин-рилизинг-гормона (GnRH) сигнальный путь и пути передачи сигналов Wnt, которые используются в межклеточная коммуникация и коммуникация между одной и той же клеткой, и которые участвуют в ряд процессов развития, включая судьбу клеток, формирование паттерна и эмбриональное развитие.

    Список путей KEGG для дифференциально экспрессируемых генов. По оси ординат указано название метаболического пути KEGG, а по оси абсцисс — отношение количества генов, аннотированных к путям, и отношение количества число к общему количеству аннотированных генов.

    Таблица 5

    Список пути KEGG для дифференциально экспрессируемых генов.

    Gene_ID T03_FPKM T04_FPKM T05_FPKM T06_FPKM FDR log2FC 4,150825 5,81225 0,255614 0 2,19 × 10-8 -5,423989078 Вниз
    c255508.graph_c046 9279,07 9279 02946
    -5,4

    72
    Вниз
    c216167.graph_c0 3,503095 3,683175 0 0,153099 1,45 × 1027-7 Вниз
    c213220.graph_c0 42.23808 25.56573 1.576416 0 2,17 × 10-6 -5.586174279 2,17 × 10-6 -5.5861779129 27 2,17 × 10-6 0.206031 0,084076 0,000318 -5.700472831 Вниз
    c234781.graph_c0 3.565642 2.983527 0 5,62 × 10-9 -5,72286459 Вниз
    c205824.graph_c0 60.33108 29.98383 9462992 29.98383 9462992 29.98383 1.6614929 6279 c186936.graph_c0 11.88476 7.719809 0.358473 0 5.51 × 10-8 -5.

    6357

    Вниз
    7,375337 16,70711 0,348416 0,050778 0,000162 -6,026948944 Вниз
    c269805.graph_c1 1,764625 1,458607 0,046992 0 1,71 × 10-8 -6,252171838 Пух
    c249220.graph_c0 2,273626 3,0725 0,074674 0 1,39 × 10-11 -6.302035053 Вниз
    c186446.graph_c0 11.48321 15.84912 0.244637 0.124787 1.79 × 10-21

    6 1.79 × 10-21
    0,370987 0,075695 2,43 × 10-30 -6,378435949 Вниз
    c264196.graph_c1 48,64439 35.18299 0,736622 0,325645 4,56 × 10-16 -6,418455493 Вниз
    c213765.graph_c0 7,572708 7,572708 7,572709 6.5541524 Вниз
    c277048.graph_c0 11.80391 10.53549 0 0,23265 6.41 × 10-10 -6.6116718021 -6.6116718021 -6.6116718021 graph_c0 3,225231 2,574819 0,064854 0 1,86 × 10-9 -6,635780171 Вниз
    c276524.907,5469 94629470
    c276524.graph_c 946279 946279 946279
    -6.740265327 Вниз
    c211503.graph_c0 35.61218 42.42217 0,753441 0 1.02 × 10-28 -6,837800434 Вниз
    c247833.graph_c0 2,17709 4.000148 0,04469 0 4,04 × 4 1027-7 0 4,04 × 4 1027 -7

    6 927

    0358 9469 9027 99029 9359 6

    927 927 927 927 927 927 946 927 946 927 946 927 946 927 946
    9299 904 927 9279 Молекулы клеточной адгезии (CAM)
    Pathway UniGene Связанный UniGene P-значение
    номер номер
    Сигнальный путь кальция 14 256 0,000732
    Пуриновый метаболизм 10 216 0,013191 216 0,013191 216 0,013191 216 0,013191
    Гепатит С 2 11 0,020433
    Метаболизм глицерофосфолипидов 6 110 0.025347
    Яичниковый стероидогенез 1 2 0,040695
    Щелевое соединение 6 124 0,041997 124 0,041997 Метаболизм аргинина и пролина 5 97 0,048928
    Биосинтез жирных кислот 2 18 0.051776
    Сокращение гладких мышц сосудов 6 141 0,069851
    Опосредованное прогестероном созревание ооцитов 5 110 0,0746 0.10318
    Адренергическая передача сигналов в кардиомиоцитах 7 194 0.104117
    Фагосома 7 196 0.108383
    Меланогенез 5 126 0,117174
    Трансэндотелиальная миграция лейкоцитов 1 6 1 6 0,117218 0,117218 6 165 0.123714

    3.6. Проверено с помощью qRT-PCR

    Набор из пяти генов, соответствующих β-актину (CALM, DS3, ZP3, CAMK4 и CPCX1), были выбраны для проверки дифференциального выражения qRT-PCR, как подробно описано в разд.2. Из этих генов CALM и DS3 были более выражены у утки-муларда, чем у утки-муларда. утки по-пекински, тогда как остальные три кандидата были более высоки экспрессируется в утке по-пекински, как наблюдали в результатах транскриптома описано выше. Гены CAMK4, CALM и ZP3 являются ключевыми значимыми дифференциальные гены, связанные с воспроизводством и развитием, которые будут служить как основа для дальнейших исследований дифференциальных генов; с FDR (ложь уровень обнаружения) как ключевой показатель для скрининга, дифференциально выраженный гены DS3 и CPCX1 наиболее значительно обогащены у утки-муларда и Пекинская утка для эффективной проверки результатов секвенирования транскриптома.Анализ этих генов методом qRT-PCR с использованием независимых биологических образцов подтвердили транскриптомные результаты с уровнями экспрессии CALM и DS3 у уток-мулардов выше, чем у пекинских уток, тогда как уровни экспрессии ZP3, CAMK4 и CPCX1 были выше у уток Пекина, чем у уток-мулардов (рис. 6).

    Проверка данных последовательности РНК с помощью ПЦР в реальном времени для выбранных генов. FPKM — это широко используемый метод оценки уровней экспрессии генов в анализ данных транскриптома; log2 (кратное изменение) — логарифм разница в экспрессии генов между двумя образцами, которая используется для измерения различия в выражении.

    4. Обсуждение

    В настоящем исследовании использовалось секвенирование транскриптома для получения набора DEG. сравнение семенников уток муларда и пекина для выяснения регуляторных генов и пути экспрессии, которые могут быть связаны со стерильным фенотипом, которые означает аномальное развитие яичек в этом исследовании. Наш анализ дал 2131 DEG, которые были проанализированы по классификации KEGG со значительным обогащением. наблюдается в ряде биохимических метаболических и сигнальных путей, а также в некоторых ДЭГ, идентифицированные как тесно связанные с репродуктивным процессом и развитие.

    Хотя процессы развития и дифференциации, ведущие к зрелому и функциональная мужская репродуктивная система сложны, и наше понимание является неполным, некоторые потенциально интересные идеи можно получить из наших анализы. В настоящее время различные исследования показали, что как p53 (Li et al. al., 2013) и метаболические сигнальные пути Wnt (Zheng et al., 2014) способствуют репродуктивному развитию мужчин. Предполагается, что путь передачи сигналов MAPK, регулируемый внеклеточными сигналами, протеинкиназа (MEK) / серин-треониновая протеинкиназа (MOS) / MAPK участвует в сперматогенезе млекопитающих, собственно мейотическая (ре) инициация и последующие аспекты митоза и посредничество перекрестного взаимодействия с фактором, способствующим созреванию (Almog et al., 2008; Show et al., 2008; Sun et al., 1999). Другие участники, указанные в Набор данных Mulard DEG включал GnRH и его нижестоящие сигнальные пути, регулирующие секрецию репродуктивной гормоны через гонадную ось у животных в сочетании с гипоталамической нейрогормоны, которые способствуют высвобождению гонадотропинов из гипофиза регулировать эндокринологические аспекты и аспекты развития животных размножение (Lee et al., 2008).

    Santi et al. (1998) обнаружили, что кальций (Ca2 +) является важным вторичным мессенджер в эукариотических клетках, а также передача сигналов кальция и поток кальция участвуют в разнообразных клеточных процессах, включая сперматогенез и физиологическая активность (подвижность и реакция) сперматозоидов.Кальций передача сигналов также регулирует фосфолипазу 2 (PLA2), которая, в свою очередь, играет важная роль во время акросомной реакции, которая имеет решающее значение для мужчины репродуктивные процессы емкости сперматозоидов и слияния сперматозоидов с яйцеклеткой. В активация и регуляция активности PLA2 сперматозоидов также опосредуются специфические рецепторы, связанные с G-белком, согласно Yuan et al. (2003). В пределах В этом контексте мы идентифицировали шесть родственных генов (CACNA1I, PLCZ, PLN, PHKA / B, CAMK4 и PDE1), которых было значительно больше у утки по-пекински. чем у утки-муларда, а три гена (CACNA1D, RYR2 и CALM) были более в тканях семенников утки муларда больше, чем в тканях пекинской утки.Фосфолипаза C zeta (PLCZ) играет важную роль во время сперматогенеза, слияние сперматозоидов и яйцеклеток, эмбриональное развитие и катализирование реакций (Giesecke et al., 2010; Swann et al., 2006). Ле Наур и др. (2000) показали что активность PLCZ не только влияет на оплодотворение, но и играет важную роль. важную роль в эмбриональном развитии, особенно в продвижении яиц деление на раннем этапе эмбрионального развития на стадию бластоцисты. Утрата экспрессии PLCZ в семенниках утки-муларда может быть критическим фактором способствуя дефектам, связанным с ответом на сперматогенез, нормальное эмбриональное развитие, сочетание сперматозоидов и яйцеклеток и другие репродуктивные процессы, которые приводят к бесплодию у этих уток.Известно, что кальций-кальмодулин-зависимая протеинкиназа IV (CAMK4) играет важную роль. важную роль в судьбе клеток и развитии зародышевых клеток. CAMK4 способствует регуляция мейоза, спаривания хромосом и поддержание генома целостность во время генезиса и развития зародышевых клеток. Таким образом, уменьшенное относительная экспрессия CMK4, наблюдаемая у утки-муларда, может привести к нарушению мейоз и образование половых клеток. Один потенциальный механизм, с помощью которого CAMK4 может действовать через регуляцию протамина путем фосфорилирования, реакция, необходимая для нормального функционирования сперматозоидов (Dada et al., 2012). PPAR выполняет плейотропные функции, включая функцию процесса у млекопитающих. воспроизводство и регуляция сперматогенеза (Kobayashi et al., 2003). Потеря активности PPAR может привести к дисфункции интерстициальных клеток Лейдига, которые вырабатывают тестостерон в ответ на ведущий лютеинизирующий гормон. к порокам развития андроген-зависимой мужской репродуктивной системы, включая нормальную функцию яичек у взрослых, что отрицательно влияет на сперматогенез и фертильность. Обычно считается, что стероид производство регулируется трофическим гормоном, который способствует транспортировке холестерина из мест хранения и синтеза во внутреннюю часть митохондрий. мембрана.Zhao et al. (2005) показали, что пролифераторы пероксисом могут блокировать транспорт, индуцированный трофическими гормонами и, таким образом, влияющий на самцов репродуктивная система. Наши данные показали, что ДЭГ, соответствующие PPAR пути в семенниках уток-мулардов были значительно обогащены (в этом выражен на гораздо более низком уровне) по сравнению с пекинскими утки. Это говорит о том, что отсутствие или снижение функции этого пути может способствуют репродуктивным нарушениям, наблюдаемым у уток-мулардов.Эта учеба проверили и выбрали три гена с пониженной регуляцией (GK; коА-лигаза длинноцепочечных жирных кислот, ACSBG; аквапорин-7, AQP7) и один активированный ген (аргининосукцинатсинтаза, AS). Среди обследованных ДЭГ на этом пути. Сузуки-Тойота и др. (1999) предположили, что AQP7 значительно экспрессируется на плазматической мембране сперматозоидов в семенниках и придаток яичка. Известно, что экспрессия AQP7 в сперматозоидах влияет на сперму. качество. Низкая экспрессия гена AQP7 в семенниках уток мулардов может сильно влияют на производство или качество спермы, что приводит к ненормальным развитие семенников у уток-мулардов.

    Некоторые пути, которые, по-видимому, аномально экспрессировались у утки муларда, были обнаружил, что не имеет прямой связи с фертильностью. К ним относятся различные нейроактивные взаимодействия лиганд-рецептор. Мы предполагаем, что эти может участвовать в развитии нервного тела, что может иметь косвенное влияние с точки зрения поведения, активности и функции яичек. Выявленные дополнительные пути включают путь пурина / глицеролипида. метаболизм, который может обеспечивать пулы нуклеотидов и передачу сигналов события, критические для функции яичек.

    5. Заключение

    Набор ДЭГ был идентифицирован при сравнительном анализе экспрессии генов. между тканями семенников мулардов и пекинских уток. Дифференциальное регулирование генетические пути, участвующие в сперматогенезе, мейозе и слиянии сперматозоидов и яйцеклеток наблюдалась у уток-мулардов, что обеспечивает сети кандидатов и гипотезы, объясняющие фенотип мужской стерильности у уток мулардов. Наш данные послужили основой для дальнейших функциональных исследований с целью выяснения механизмы гибридной стерильности, исследование нормального развития яичек и функции, и предоставить средства для терапевтического нацеливания, чтобы преодолеть отсутствие репродуктивной силы наблюдается у утки-муларда.

    Благодарности

    Работа поддержана Национальная программа ключевых исследований и разработок Китая (2017YFE0122000), Национальный фонд естественных наук Китая (U1803232, 31670026), Фонд естественных наук Фуцзянь (2018J01041), Общественная организация провинции Фуцзянь Научный проект благосостояния (2017R1023-5) и инновации молодых талантов Фонд Фуцзянской академии сельскохозяйственных наук (MYQJ (S) 2018-2).

    Доступность данных

    Исходные данные были загружены в базу данных Sequence Read Archive (SRA) (доступ: PRJNA657980, Фуцзянская академия сельскохозяйственных наук, 2020).

    Вклад авторов

    JQ и NZ разработали эксперименты, а LL выполнили их вне. ZZha и ZW шлифовали англичан. NOK просмотрел документ и сделал комментарии. LZ, QX, ZM и ZZhu собрали образцы. LL подготовил статью с вклад всех соавторов.

    Конкурирующие интересы

    Авторы заявляют об отсутствии конфликта интересов.

    Финансовая поддержка

    Это исследование поддержано Национальная программа ключевых исследований и разработок Китая (грант нет.2017YFE0122000), Национальный фонд естественных наук Китая (гранты № U1803232 и 31670026), Фуцзянь Фонд естественных наук (грант № 2018J01041), Научный проект общественного благосостояния провинции Фуцзянь (грант № 2017R1023-5) и Фонд инноваций молодых талантов Фуцзянской академии сельскохозяйственных наук (грант № MYQJ (S) 2018-2) .

    Заявление о проверке

    Эта статья была отредактирована Штеффеном Мааком и проверена двумя анонимными рецензентами.

    Ссылки

    • Almog T, Naor Z.Митоген-активируемые протеинкиназы (MAPK) как регуляторы сперматогенеза и функций сперматозоидов. Mol Cell Endocrinol. 2008; 282: 39–44. DOI: 10.1016 / j.mce.2007.11.011. [PubMed] [CrossRef] [Google Scholar]
    • Чен Л., Хуанг X, Тиан З., Тао З., Лу Л. Идентификация генов, связанных с синей яичной скорлупой у уток (Anasplatyrhynchos domesticus) с помощью анализа транскриптома. Журнал сельскохозяйственной биотехнологии. 2016; 24: 1064–1072. [Google Scholar]
    • Конг Ф, Лю X, Хань З., Шао И, Конг X, Лю С.Транскриптомный анализ тканей куриных почек после заражения вирусом птичьего инфекционного бронхита коронавирусом. BMC Genomics. 2013; 14: 743. DOI: 10.1186 / 1471-2164-14-743. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Дада Р., Кумар М., Хесудасан Р., Фернандес Дж. Л., Госалвес Дж., Агарвал А. Эпигенетика и ее роль в мужском бесплодии. J Assist Reprod Gen, 2012; 29: 213–223. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Фуцзянская академия сельскохозяйственных наук: секвенирование утиных семенников (поиск дифференциально экспрессируемых генов в гонадах Утки муларды и родители) NCBI; [последний доступ: 19 августа 2020 г.].доступно по адресу: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA657980. [Google Scholar]
    • Giesecke K, Sieme H, Distl O. Маркеры генов-кандидатов и бесплодия для жеребцов фертильности. Вет Дж. 2010; 185: 265–271. DOI: 10.1016 / j.tvjl.2009.07.024. [PubMed] [CrossRef] [Google Scholar]
    • Кобаяши Т., Ниими С., Каваниши Т., Фукуока М., Хаякава Т. Изменения в экспрессии γ-регулируемого гена рецептора, активируемого пролифератором пероксисом, и экспрессии генов системы ингибин / активин – фоллистатин у крыс яички после введения ди-н-бутилфталата.Toxicol Lett. 2003. 138: 215–225. DOI: 10.1016 / S0378-4274 (02) 00414-9. [PubMed] [CrossRef] [Google Scholar]
    • Ли В.Х., Ли Л.Т., Чоу Б.К. Гонадотропин-рилизинг-гормон: регуляция гена GnRH. FEBS J. 2008; 275: 5458–5478. DOI: 10.1111 / j.1742-4658.2008.06676.x. [PubMed] [CrossRef] [Google Scholar]
    • Le Naour F, Rubinstein E, Jasmin C, Prenant M, Boucheix C. Сильно сниженная фертильность самок у мышей с дефицитом CD9. Наука. 2000. 287: 319–321. [PubMed] [Google Scholar]
    • Li GY, Xie P, Li HY, Hao L, Xiong Q, Qiu T.Участие путей p53, Bax и Bcl-2 в индуцированном микроцистинами апоптозе семенников крысы. Environ Toxicol. 2013; 26: 111–117. DOI: 10.1002 / tox.20532. [PubMed] [CrossRef] [Google Scholar]
    • Лю И, Хе С., Цзэн Т., Ду Х, Шэнь Дж., Чжао А., Лу Л. Транскриптомный анализ печени утят, вылупившихся нормально и с помощью. Asian Austral J Anim. 2017; 30: 773. DOI: 10.5713 / ajas.16.0528. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Ливак К.Дж., Шмитген Т.Д. Анализ данных относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2-ΔΔCT.Методы. 2001; 25: 402–408. DOI: 10.1006 / meth.2001.1262. [PubMed] [CrossRef] [Google Scholar]
    • Santi CM, Santos T., Hernández-Cruz A, Darszon A. Свойства нового pH-зависимого пути проникновения Ca2 +, присутствующего в мужских половых клетках, с возможной ролью в сперматогенезе и функции зрелых сперматозоидов . J Gen Physiol. 1998; 112: 33–53. DOI: 10.1085 / jgp.112.1.33. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Schulze SK, Kanwar R, Gölzenleuchter M, Therneau TM, Beutler AS. SERE: Однопараметрический контроль качества и сравнение образцов для RNA-Seq.BMC Genomics. 2012; 13: 524. DOI: 10.1186 / 1471-2164-13-524. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Show MD, Hill CM, Anway MD, Wright WW, Zirkin BR. Фосфорилирование митоген-активированной протеинкиназы 8 (MAPK8) связано с апоптозом зародышевых клеток и перераспределением Bcl2-модифицирующего фактора (BMF) J Androl. 2008. 29: 338–344. DOI: 10.2164 / jandrol.107.003558. [PubMed] [CrossRef] [Google Scholar]
    • Sun QY, Breitbart H, Schatten H. Роль каскада MAPK в зародышевых клетках млекопитающих.Reprod Fert Develop. 1999; 11: 443–450. DOI: 10.1071 / RD00014. [PubMed] [CrossRef] [Google Scholar]
    • Suzuki-Toyota F, Ishibashi K, Yuasa S. Иммуногистохимическая локализация водного канала, аквапорин 7 (AQP7), в семенниках крысы. Cell Tissue Res. 1999; 295: 279–285. [PubMed] [Google Scholar]
    • Суонн К., Сондерс К.М., Роджерс Н.Т., Лай Ф.А. PLCζ (дзета): белок спермы, который запускает колебания Ca2 + и активацию яйцеклетки у млекопитающих. Semin Cell Dev Biol. 2006. 17: 264–273. DOI: 10.1016 / j.semcdb.2006.03.009. [PubMed] [CrossRef] [Google Scholar]
    • Тан Дж, Чен Х, Сонг Дж, Лю Ю. Исследования репродуктивного характера уток Муларда. Журнал сельскохозяйственных наук провинции Фуцзянь. 1998; 13: 41–45. [Google Scholar]
    • Xu Q, Zhao W., Chen Y, Tong Y, Rong G, Huang Z, Chen G. Транскриптомное профилирование яичников гуся (Anser cygnoides) позволяет идентифицировать фенотипы откладывания и насиживания. ПлоС один. 2013; 8: e55496. DOI: 10.1371 / journal.pone.0055496. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    • Yu DB, Jiang BC, Gong J, Dong FL, Lu YL, Yue HJ, Wang ZC, Du WX, Guo AY.Идентификация новых и дифференциально экспрессируемых микроРНК в яичниках уток-несушек и уток-несушек. J Integr Agr. 2013; 12: 136–146. [Google Scholar]
    • Yuan YY, Chen WY, Shi QX, Mao LZ, Yu SQ, Fang X, Roldan ERS. Zona pellucida индуцирует активацию фосфолипазы A2 во время акросомального экзоцитоза сперматозоидов морских свинок. Биол Репрод. 2003. 68: 904–913. [PubMed] [Google Scholar]
    • Цзэн Т., Чжан Л., Ли Дж., Ван Д., Тиан Ю., Лу Л. Сборка и характеристика транскриптома печени мускусной утки и анализ дифференциально регулируемых генов в ответ на тепловой стресс.Клеточный стресс и шапероны. 2015; 20: 483–493. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Zhao Y, Yang Z. Путь передачи сигналов PPARs в репродукции млекопитающих. Китайский журнал клеточной биологии. 2005; 27: 14–18. [Google Scholar]
    • Zheng W., Zhao ZS, Li QF, Ban Q, Li HT, Liang YW. Анализ различий микроРНК в женских и мужских эмбрионах гибрида курица-перепел с помощью секвенирования solexa. Китайский журнал ветеринарии. 2014; 34: 116–122. [Google Scholar]
    • Zhu Z, Miao Z, Chen H, Xin Q, Li L, Lin R, Haung Q, Zheng N.Транскриптомный анализ яичников уток Шан Ма на пике и поздних стадиях яйценоскости. Asian Austral J Anim. 2017; 30: 1215–1224. DOI: 10.5713 / ajas.16.0470. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
    .